Previous Contig 009619:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027F04Sequence560009619 (4)gb:ATAC016829_15436612e-42Arabidopsis thaliana chromosome III BAC T6K12 genomic sequence, complete sequenc
JMFF030A22Sequence544001376 (3)745009619 (4)gb:AY180382_15875533e-52Medicago truncatula apyrase-like protein (APY2) mRNA, complete cds.
JMSF008C22Sequence369001376 (3)728009619 (4)gb:AY180382_15875534e-48Medicago truncatula apyrase-like protein (APY2) mRNA, complete cds.
JMSF034B04Sequence668001376 (3)gb:AY140045_15824852e-44Arabidopsis thaliana unknown protein mRNA, complete cds.708009619 (4)gb:AY180382_15875532e-51Medicago truncatula apyrase-like protein (APY2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027F04+ TATGGTTCAAGCATGACGAGTTGTAGGGA
rJMSF008C22+ GCCTTATGGTTCAAGCATGACGAGTTGTAGGGA
rJMSF034B04+ AGCATGACGAGTTGTAGGGA
rJMFF030A22+ TATGGTTCAAGCATGACGAGTTGTAGGGA
                      ____________________________________________________________
consensus GCCTTATGGTTCAAGCATGACGAGTTGTAGGGA
 
. : . : . : . : . : . :
rJMFF027F04+ GGTGGTTATTAAGGCTCTCAAAGTCAATGGATCAGCNTGCACTCACATGAAATGCACATT
rJMSF008C22+ GGTGGTTATTAAGGCTCTCAAAGTCAATGGATCAGCCTGCACTCACATGAAATGCACATT
rJMSF034B04+ GGTGGTTATTAAGGCTCTCAAAGTCAATGGATCAGCCTGCACTCACATGAAATGCACATT
rJMFF030A22+ GGTGGTTATTAAGGCTCTCAAAGTCAATGGATCAGCCTGCACTCACATGAAATGCACATT
                      ____________________________________________________________
consensus GGTGGTTATTAAGGCTCTCAAAGTCAATGGATCAGCCTGCACTCACATGAAATGCACATT
 
. : . : . : . : . : . :
rJMFF027F04+ NGGAGGGGTGTGGAATGGTGGTGGAGGCAATGGTC-AAAAGAATNCTATTTGTTGNTTCA
rJMSF008C22+ TGGAGGGGTGTGGAATGGTGGTGGAGGCAATGGTCAAAAAGAAT-CTATTTGTTGCTTCA
rJMSF034B04+ TGGAGGGGTGTGGAATGGTGGTGGAGGCAATGGTC-AAAAGAAT-CTATTTGTTGCTTCA
rJMFF030A22+ TGGAGGGGTGTGGAATGGTGGTGGAGGCAATGGTC-AAAAGAAT-CTATTTGTTGCTTCA
                      ____________________________________________________________
consensus TGGAGGGGTGTGGAATGGTGGTGGAGGCAATGGTC-AAAAGAAT-CTATTTGTTGCTTCA
 
. : . : . : . : . : . :
rJMFF027F04+ TTTTTCTTNGACAGAGCTTCTGAGGTTGGAATCGTTGCTGATCCAAATGCGGCTGTTGCA
rJMSF008C22+ TTTTTCTTTGACAGAGCTTCTGAGGTTGGAATCGTTGCTGATCCAAATGCGGCTGTTGCA
rJMSF034B04+ TTTTTCTTTGACAGAGCTTCTGAGGTTGGGATCGTTGCTGATCCAAATGCGGCTGTTGCA
rJMFF030A22+ TTTTTCTTTGACAGAGCTTCTGAGGTTGGAATCGTTGCTGATCCAAATGCGGCTGTTGCA
                      ____________________________________________________________
consensus TTTTTCTTTGACAGAGCTTCTGAGGTTGGAATCGTTGCTGATCCAAATGCGGCTGTTGCA
 
. : . : . : . : . : . :
rJMFF027F04+ AAAGTTCGCCCAGTTGATTTTGAAAGTGCAGCTTCAAGTGCTTGTTCATCCGGGCTCGAG
rJMSF008C22+ AAAGTTCGCCCAGTTGATTTTGAAAGTGCAGCTTCAAGTGCTTGTTCAACCGGGCTCGAG
rJMSF034B04+ AAAGTTCGCCCAGTTGATTTTGAAAGTGCAGCTTCAAGTGCTTGTTCAACCGGGCTCGAG
rJMFF030A22+ AAAGTTCGCCCAGTTGATTTTGAAAGTGCAGCTTCAAGTGCTTGTTCAACCGGGCTCGAG
                      ____________________________________________________________
consensus AAAGTTCGCCCAGTTGATTTTGAAAGTGCAGCTTCAAGTGCTTGTTCAACCGGGCTCGAG
 
. : . : . : . : . : . :
rJMFF027F04+ GATGCCAAATCCAAATTTCCTNGTANTGATCCAAATANCTTGCCATACTTGTGTATGGAT
rJMSF008C22+ GATGCCAAATCCAAATTTCCTCGTATTGATCCAAATAACTTGCCATACTTGTGTATGGAT
rJMSF034B04+ GATGCCAAATCCAAATTTCCTCGTATTGATCCAAATAACTTGCCATACTTGTGTATGGAT
rJMFF030A22+ GATGCCAAATCCAAATTTCCTCGTATTGATCCAAATAACTTGCCATACTTGTGTATGGAT
                      ____________________________________________________________
consensus GATGCCAAATCCAAATTTCCTCGTATTGATCCAAATAACTTGCCATACTTGTGTATGGAT
 
. : . : . : . : . : . :
rJMFF027F04+ CTTACTTACGAGTTCAGTTTGNTGGTTGATGGCTTCGGCATAGGTCCTCAACAATNCATC
rJMSF008C22+ CTTACTTACGAGTTCAGTTTGCTGGTTGATGGCTTCGGCATAGGTCCTCAACAATACATC
rJMSF034B04+ CTTACTTACGAGTTCAGTTTGCTGGTTGATGGCTTCGGCATAGGTCCTCAACAATACATC
rJMFF030A22+ CTTACTTACGAGTTCAGTTTGCTGGTTGATGGCTTCGGCATAGGTCCTCAACAATACATC
                      ____________________________________________________________
consensus CTTACTTACGAGTTCAGTTTGCTGGTTGATGGCTTCGGCATAGGTCCTCAACAATACATC
 
. : . : . : . : . : . :
rJMFF027F04+ ACATTGGTAAAGAAAGTCAAATACCAAAACTCCCTNGTCGAAGCGGCTTGGCCACTGGGC
rJMSF008C22+ ACATTGGTAAAGAAAGTCAAATACCAAAACTCCCTTGTCGAAGCGGCTTGGCCACTGGGC
rJMSF034B04+ ACATTGGTAAAGAAAGTCAAATACCAAAACTCCCTTGTCGAAGCGGCTTGGCCACTGGGC
rJMFF030A22+ ACATTGGTAAAGAAAGTCAAATACCAAAACTCCCTTGTCGAAGCGGCTTGGCCACTGGGC
                      ____________________________________________________________
consensus ACATTGGTAAAGAAAGTCAAATACCAAAACTCCCTTGTCGAAGCGGCTTGGCCACTGGGC
 
. : . : . : . : . : . :
rJMFF027F04+ AGCGCCATTGAAGCAGTTTCGTAAGTGCACAAGGCCTTNANTATTACACTCCGAGTTGCA
rJMSF008C22+ AGCGCCATTGAAGCAGTTTCGTAAGTGCACAAGGCCTTAACTATTACACTCCGAGTTGCA
rJMSF034B04+ AGCGCCATTGAAGCAGTTTCGTAAGTGCACAAGGCCTTAACTATTACACTCCGAGTTGCA
rJMFF030A22+ AGCGCCATTGAAGCAGTTTCGTAAGTGCACAAGGCCTTAACTATTACACTCCGAGTTGCA
                      ____________________________________________________________
consensus AGCGCCATTGAAGCAGTTTCGTAAGTGCACAAGGCCTTAACTATTACACTCCGAGTTGCA
 
. : . : . : . : . : . :
rJMFF027F04+ GTNTANTNCCGGCCAGTTATGNCTATGAAGTGCTGATATATTATCTTTCCA
rJMSF008C22+ GTCTACTACCGGCCAGTTATG-CTATGAAGTGCTGATATATTATCTTTCCAGTTCCCACC
rJMSF034B04+ GTCTACTACCGGCCAGTTATG-CTATGAAGTGCTGATATATTATCTTTCCAGTTCCCACC
rJMFF030A22+ GTCTACTACCGGCCAGTTATG-CTATGAAGTGCTGATATATTATCTTTCCAGTTCCCACC
                      ____________________________________________________________
consensus GTCTACTACCGGCCAGTTATG-CTATGAAGTGCTGATATATTATCTTTCCAGTTCCCACC
 
. : . : . : . : . : . :
rJMSF008C22+ ATCAGCGCGTCTGTGAAGAGAAATTTTGGATGTTTTGTTATTGGGTGGGTCGATAAGAAT
rJMSF034B04+ ATCAGCGCGTCTGTGAAGAGAAATTTTGGATGTTTTGTTATTGGGTGGGTCGATAAGAAT
rJMFF030A22+ ATCAGCGCGTCTGTGAAGAGAAATTTTGGATGTTTTGTTATTGGGTGGGTCGATAAGAAT
                      ____________________________________________________________
consensus ATCAGCGCGTCTGTGAAGAGAAATTTTGGATGTTTTGTTATTGGGTGGGTCGATAAGAAT
 
. : . : . : . : . : . :
rJMSF008C22+ AATGAGAAATCTTTGTTGTGATTCTGATTTATAATTGATGAAGTAATATATTTAGCAGTA
rJMSF034B04+ AATGAGAAATCTTTGTTGTGATTCTGATTTATAATTGATGAAGTAATATATTTAGCAGTA
rJMFF030A22+ AATGAGAAATCTTTGTTGTGATTCTGATTTATAATTGATGAAGTAATATATTTAGCAGTA
                      ____________________________________________________________
consensus AATGAGAAATCTTTGTTGTGATTCTGATTTATAATTGATGAAGTAATATATTTAGCAGTA
 
. : . : . : . : . : . :
rJMSF008C22+ TTCATTCTTGTAAAGGCTACCTGGACTCTACC
rJMSF034B04+ TTCATTCTTGTAAAGGCTA-CTGGACTCTACC
rJMFF030A22+ TTCATTCTTGTAAAGGCTA-CTGGACTCTACCATTCTGAAACTTATGCTATACAGAGGCT
                      ____________________________________________________________
consensus TTCATTCTTGTAAAGGCTA-CTGGACTCTACCATTCTGAAACTTATGCTATACAGAGGCT