Previous Contig 009612:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011G17Sequence587009612 (10)pir|G86287|G862879e-30hypothetical protein F9L1.28 - Arabidopsis thaliana>gb:AE005172_890531 Arabidops531009612 (10)
JMFF029O19Sequence729009612 (10)gb:AF286471S2_18950346e-06Homo sapiens retinitis pigmentosa GTPase regulator (RPGR) gene, exon ORF15 parti
JMFF035C15Sequence528009612 (10)gb:AB017071_15135043e-29Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MSJ11.>gb:BT015051_164672009612 (10)gb:AF286471S2_18950349e-06Homo sapiens retinitis pigmentosa GTPase regulator (RPGR) gene, exon ORF15 parti
JMSF007J21Sequence320009612 (10)gb:AF083737_17669672e-20Arabidopsis thaliana clone sps418 unknown mRNA.774009612 (10)gb:AF286471S2_18950348e-07Homo sapiens retinitis pigmentosa GTPase regulator (RPGR) gene, exon ORF15 parti
JMSF008J21Sequence315018579gb:AY273869_6049760.005Pseudomonas aeruginosa PA14 pathogenicity island PAPI-1, complete sequence.666009612 (10)gb:AF385629_14193340.001Canis familiaris retinitis pigmentosa GTPase regulator (RPGR) gene, exon ORF15 a
JMSF019F13Sequence583009612 (10)gb:AY863051_16309851e-28Zea mays putative methyl-binding domain protein MBD115 mRNA, complete cds.629006915 (20)gb:AF098458_17679152e-53Hevea brasiliensis latex-abundant protein (LAR) mRNA, complete cds.
JMSF050D24Sequence659020520722009612 (10)pir|G86287|G862871e-10hypothetical protein F9L1.28 - Arabidopsis thaliana>gb:AE005172_890531 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF019F13- GGG
                      ____________________________________________________________
consensus GGG
 
. : . : . : . : . : . :
JMSF007J21- GA
JMFF035C15- GTAGAGCTTTCTAGTTTCTAGCATTTAGAGAGAGAGAGAGA
JMSF019F13- ACCAGTGGCACGTATGTGAGTAGAGCTTTCTAGTTTCTAGCATTTAGAGAGAGAGAGAGA
                      ____________________________________________________________
consensus ACCAGTGGCACGTATGTGAGTAGAGCTTTCTAGTTTCTAGCATTTAGAGAGAGAGAGAGA
 
. : . : . : . : . : . :
JMSF007J21- GAGAGGAACAGAGCTGGTAGCTAGTCCTGCGTTTTTCTTTGATTGGGGGAGACGAAAATG
JMFF035C15- GAGAGGAACAGAGCTGGTAGCTAGTCCTGCGTTTTTCTTTGATT-GGGGAGACGAAAATG
JMSF019F13- GAGAGGAACAGAGCTGGTAGCTAGTCCTGCGTTTTTCTTTGATT-GGGGAGACGAAAATG
JMFF011G17- AGCTAGTCCTGCGTTTTTCTTTGATT-GGGGAGACGAAAATG
                      ____________________________________________________________
consensus GAGAGGAACAGAGCTGGTAGCTAGTCCTGCGTTTTTCTTTGATT-GGGGAGACGAAAATG
 
. : . : . : . : . : . :
JMSF007J21- GCGAATTCTGAAGAAAAGATGGCTCAAAACCTGACTGAAGGAACAGATGGAGTTCTCTCT
JMFF035C15- GCGAATTCTGAAGAAAAGATGGCTCAAAACCTGACTCAAGGAACAGATGGAGTTCTCTCT
JMSF019F13- GCGAATTCTGAAGAAAAGATGGCTCAAAACCTGACTCAAGGAACAGATGGAGTTCTCTCT
JMFF011G17- GCGAATTCTGAAGAAAAGATGGCTCAAAACCTGACTCAAGGAACAGATGGAGTTCTCTCT
                      ____________________________________________________________
consensus GCGAATTCTGAAGAAAAGATGGCTCAAAACCTGACTCAAGGAACAGATGGAGTTCTCTCT
 
. : . : . : . : . : . :
JMSF007J21- GTGGAGCTTCCTGCACCTCCTTCTTGGAAGAAATTGTTAATGCATAGTGGAGGCAAGGTT
JMFF035C15- GTGGAGCTTCCTGCACCTCCTTCTTGGAAGAAATTGTTAATGCATAGTGGAGGCAAGGTT
JMSF019F13- GTGGAGCTTCCTGCACCTCCTTCTTGGAAGAAATTGTTAATGCATAGTGGAGGCAAGGTT
JMFF011G17- GTGGAGCTTCCTGCACCTCCTTCTTGGAAGAAATTGTTAATGCATAGTGGAGGCAAGGTT
                      ____________________________________________________________
consensus GTGGAGCTTCCTGCACCTCCTTCTTGGAAGAAATTGTTAATGCATAGTGGAGGCAAGGTT
 
. : . : . : . : . : . :
JMSF007J21- GTGTTTATTGCTCCCACTGGGGAAGAGATCACTAGCAAGAGACAGTTAAGCCAGTATCTG
JMFF035C15- GTGTTTATTGCTCCCACTGGGGAAGAGATCACTAGCAAGAGACAGTTAAGCCAGTATCTG
JMSF019F13- GTGTTTATTGCTCCCACTGGGGAAGAGATCACTAGCAAGAGACAGTTAAGCCAGTATCTG
JMFF011G17- GTGTTTATTGCTCCCACTGGGGAAGAGATCACTAGCAAGAGACAGTTAAGCCAGTATCTG
                      ____________________________________________________________
consensus GTGTTTATTGCTCCCACTGGGGAAGAGATCACTAGCAAGAGACAGTTAAGCCAGTATCTG
 
. : . : . : . : . : . :
JMSF007J21- AAATCACACCCTGGTAATCCTGCACCATCCAGCTTTGATTGGGGTACTGGTGATACTCCN
JMFF035C15- AAATCACACCCTGGTAATCCTGCACCATCCAGCTTTGATTGGGGTACTGGTGATACTCCA
JMSF019F13- AAATCACACCCTGGTAATCCTGCACCATCCAGCTTTGATTGGGGTACTGGTGATACTCCA
JMFF011G17- AAATCACACCCTGGTAATCCTGCACCATCCAGCTTTGATTGGGGTACTGGTGATACTCCA
rJMSF050D24+ CTCCN
                      ____________________________________________________________
consensus AAATCACACCCTGGTAATCCTGCACCATCCAGCTTTGATTGGGGTACTGGTGATACTCCA
 
. : . : . : . : . : . :
JMSF007J21- AGAAGATCTGCAAGGAT
JMFF035C15- AGAAGATCTGCAAGGATCAGTGGAAAGGTCAAGGCCAATCCCTCCCCTTCAGAGACCGAG
JMSF019F13- AGAAGATCTGCAAGGATCAGTGGAAAGGTCAAGGCCAATCCCTCCCCTTCAGAGACCGAG
JMFF011G17- AGAAGATCTGCAAGGATCAGTGGAAAGGTCAAGGCCAATCCCTCCCCTTCAGAGACCGAG
rJMSF050D24+ AGAAGATCTGCAAGGATCAGTGGAAAGGTCAAGGCCAATCCTTCCCCTTCAGAGACCGAG
                      ____________________________________________________________
consensus AGAAGATCTGCAAGGATCAGTGGAAAGGTCAAGGCCAATCCCTCCCCTTCAGAGACCGAG
 
. : . : . : . : . : . :
JMFF035C15- ATGCCCAAGAAACGACGTAGAATGTCATCTGGAAGAAAGGATAGCCAGCAGGAAACCGGT
JMSF019F13- ATGCCCAAGAAACGACGTANAATGTCATCTGGAAGAAAGGATAGCCAGCAGGAAACCGGT
JMFF011G17- ATGCCCAAGAAACGACGTAGAATGTCATCTGGAAGAAAGGATAGCCAGCAGGAAACCGGT
rJMSF050D24+ ATGCCCAAGAAACGACGTAGAATGTCATCTGGAAGAAAGGATAGCCAGCAGGAAACCGGT
rJMSF007J21+ GACGTAGAGTGTCATCTGGAAGAAAGGATAGCCAGCAGGAAACCGGT
                      ____________________________________________________________
consensus ATGCCCAAGAAACGACGTAGAATGTCATCTGGAAGAAAGGATAGCCAGCAGGAAACCGGT
 
. : . : . : . : . : . :
JMFF035C15- GAAACTGAGAGCGTGGAGATGAAAGATCTGGCAGCTTCGAACGAAGAGGGTGTGAAAGAA
JMSF019F13- GAAACTGAGAGCGTGGAGATGAAAGATCTGGCAGCTTCGAACGAAGAGGGTGTGAAAGAA
JMFF011G17- GAAACTGAGAGCGTGGAGATGAAAGATCTGGCAGCTTCGAACGAAGAGGGTGTGAAAGAA
rJMSF050D24+ GAAACTGAGAGCGTGGAGATGAAAGATCTGGCAGCTTCGAACGAAGAGGGTGTGAAAGAA
rJMFF035C15+ GAGATGAAAGATCTGGCAGCTTGGAACGAAGAGGGTGTGAAAGAA
rJMSF007J21+ GAAACTGAGAGCGTGGAGAAGAAAAATCTGGCAGCTTCGAACGAAGAGGGTGTGAAAGAA
rJMFF029O19+ GAAGAGGGTGTGAAAGAA
                      ____________________________________________________________
consensus GAAACTGAGAGCGTGGAGATGAAAGATCTGGCAGCTTCGAACGAAGAGGGTGTGAAAGAA
 
. : . : . : . : . : . :
JMFF035C15- GTCGAAAC
JMSF019F13- GTCGAAACTCCAAATGTTGAATCCACTGAACATGAGGGTGT
JMFF011G17- GTCGAAACTCCAAATGTTGAATCCACTGAACATGAGGGTGTGGAGAAAGGAAATATAACC
rJMSF050D24+ GTCGAAACTCCAAATGTTGAATCCACTGAACATGAGGGTGTGGAGAAAGGAAATATAACC
rJMSF008J21+ TCCAAATGTTGAATCCGCTGAACATGAGGGTGTGGAGAAAGGAAATATAACC
rJMFF035C15+ GTCGAAACTCCAAATGTTGAATCCACTGAACATGAGGGTGTGGAGAAAGGAAATATAACC
rJMSF007J21+ GTCGAAACTCCAAATGTTGAATCCGCTGAACATGAGGGTGTGGAGAAAGGAAATATAACC
rJMFF029O19+ GTCGAAACTCCAGATGTTGAATCCACTGAACATGAGGGTGTGGAGAAAGGAAATATANCC
                      ____________________________________________________________
consensus GTCGAAACTCCAAATGTTGAATCCACTGAACATGAGGGTGTGGAGAAAGGAAATATAACC
 
. : . : . : . : . : . :
JMFF011G17- ACACAGATTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGCGCTGAAAAGGAAAAT
rJMSF050D24+ ACACAGATTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGCGCTGAAAAGGAAAAT
rJMSF008J21+ ACACAGTTTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGTGCTGAAAAGGAAAAT
rJMFF035C15+ ACACAGATTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGCGCTGAAAAGGAAAAT
rJMSF007J21+ ACACAGTTTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGTGCTGAAAAGGAAAAT
rJMFF011G17+ AAGGTGAAGCTGANGATAATAATCTGCAAGATGGCGNTGAAAAGGAAAAT
rJMFF029O19+ ACACAGATTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGCGCTGAAAAGGAAAAT
                      ____________________________________________________________
consensus ACACAGATTCAAGGTGAAACTGAAGATAATAATCTGCAAGATGGCGCTGAAAAGGAAAAT
 
. : . : . : . : . : . :
JMFF011G17- GCATCA
rJMSF050D24+ GCATCAGAGGTTGAGGTCGAGGTT------GGGGGAAACGCTAGTACTAAAGATGGGAAT
rJMSF008J21+ GCATCAGAGGTTGAGGTTGAGGTTGAGGTCGGGGGAAACGCTAGTACTAAAGATGGGAAT
rJMFF035C15+ GCATCAGAGGTTGAGGTCGAGGTT------GGGGGAAACGCTAGTACTAAAGATGGGAAT
rJMSF007J21+ GCATCAGAGGTTGAGGTTGAGGTTGAGGTCGGGGGAAACGCTAGTACTAAAGATGGGAAT
rJMFF011G17+ GCATCAGAGGTTGAGGTCGAGGTT------GGGGGAAACGNTAGTANTAAAGATGGGANT
rJMFF029O19+ GCATCAGAGGTTGAGGTCGAGGTT------GGGGGAAACGCTAGTACTAAAGATGGGAAT
                      ____________________________________________________________
consensus GCATCAGAGGTTGAGGTCGAGGTT------GGGGGAAACGCTAGTACTAAAGATGGGAAT
 
. : . : . : . : . : . :
rJMSF050D24+ ACCTTGGATGGCTCCAAGGATGGAAACGACGGGACATCCTGGGAGGCAAATAAGACTGAA
rJMSF008J21+ ACCTTGGATGGCTCCAAGGATGGAAACTACGGGACATCCTGGGAGGCAAATAAGACTGAA
rJMFF035C15+ ACCTTGGATGGCTCCAAGGATGGAAACGACGGGACATCCTGGGAGGCAAATAAGACTGAA
rJMSF007J21+ ACCTTGGATGGCTCCAAGGATGGAAACTACGGGACATCCTGGGAGGCAAATAAGACTGAA
rJMFF011G17+ ACCTTGGATGGCTCCAAGGATGGAAACGNCGNGNCATCNTGGGAGGCAAATAAGNCTGAA
rJMFF029O19+ ACCTTGGATGGCTCCAAGGATGGAAACGACGGGACATCCTGGGAGGCAAATAAGACTGAA
                      ____________________________________________________________
consensus ACCTTGGATGGCTCCAAGGATGGAAACGACGGGACATCCTGGGAGGCAAATAAGACTGAA
 
. : . : . : . : . : . :
rJMSF050D24+ CAAGTTTCAAGTGCAGAAGGTAAAGCTGAAGGGAAACTGGGATCTGGAGAAGCCCCAGAG
rJMSF008J21+ CAAGCTTCAAGGGCAGAAGGTAAAGCTGAAGGGAAACCGGGATCTGGAGAAGCCCCAGAG
rJMFF035C15+ CAAGTTTCAAGTGCAGAAGGTAAAGCTGAAGGGAAACTGGGATCTGGAGAAGCCCCAGAG
rJMSF007J21+ CAAGCTTCAAGGGCAGAAGGTAAAGCTGAAGGGAAACCGGGATCTGGAGAAGCCCCAGAG
rJMFF011G17+ CAAGTTTCAAGTGCAGAAGGTAAAGCTGAAGGGAANCTGNGATNTGGAGAAGCCCCAGAG
rJMFF029O19+ CAAGTTTCAAGTGCAGAAGGTAAAGCTGAAGGGAAACTGGGATCTGGAGAAGCCCCAGAG
                      ____________________________________________________________
consensus CAAGTTTCAAGTGCAGAAGGTAAAGCTGAAGGGAAACTGGGATCTGGAGAAGCCCCAGAG
 
. : . : . : . : . : . :
rJMSF050D24+ AAGGAGAGTTCTGCTGCAGTGGAAGATGAAACGAAGGAAATCCAGGAAAACGATAGCGAA
rJMSF008J21+ AAGGAGAGTTCTGCTGCAATGGAAGATGAAACGAAGGAAATCCAGGAAAACGATAGCGAA
rJMFF035C15+ AAGGAGAGTTCTGCTGCAGTGGAAGATGAAACGAAGGAAATCCAGGAAAACGATAGCGAA
rJMSF007J21+ AAGGAGAGTTCTGCTGCAATGGAAGATGAAACGAAGGAAATCCAGGAAAACGATAGCGAA
rJMFF011G17+ AAGGAGAGTTCTGCTGCAGTGGAAGATGANACGAAGGAANTCCAGGAAAANGATAGNGAA
rJMFF029O19+ AAGGAGAGTTCTGCTGCAGTGGAAGATGAAACGAAGGAAATCCAGGAAAACGATAGCGAA
                      ____________________________________________________________
consensus AAGGAGAGTTCTGCTGCAGTGGAAGATGAAACGAAGGAAATCCAGGAAAACGATAGCGAA
 
. : . : . : . : . : . :
rJMSF050D24+ TTGAAGTTGCAGGAAGAGAAGGCCGGAAATAGTAGGAATGGGTTGGTCCAGGGGTTCGCG
rJMSF008J21+ TTGAAGTTGCAGGAAGAGAAGGCCGGAAATAGTAGGAACGGGTTGTTCCAGGGGTTCGCG
rJMFF035C15+ TTGAAGTTGCAGGAAGAGAAGGCCGGAAATAGTAGGAATGGGTTGGTCCAGGGGTTCGCG
rJMSF007J21+ TTGAAGTTGCAGGAAGAGAAGGCCGGAAATAGTAGGAACGGGTTGTTCCAGGGGTTCGCG
rJMFF011G17+ TNGAAGNTGCAGGAAGAGAAGGCCGGAAATAGTAGGAATGGGTTGNTCCAGGGGTTCGAG
rJMFF029O19+ TTGAAGTTGCAGGAAGAGAAGGCCGGAAATAGTAGGAATGGGTTGGTCCAGGGGTTCGCG
                      ____________________________________________________________
consensus TTGAAGTTGCAGGAAGAGAAGGCCGGAAATAGTAGGAATGGGTTGGTCCAGGGGTTCGCG
 
. : . : . : . : . : . :
rJMSF050D24+ AATACCCCACACCATCCCTCTCCTGCACCAATTAGCTGCTAAACACAACATGTTTATCTA
rJMSF008J21+ AATACCCCACACCATCCCTCTCCTGCACCAATTAGCTGCTAAACACAACATGTTTATCTA
rJMFF035C15+ AATACCCCACACCATCCCTCTCCTGCACCAATTAGCTGCTAAACACAACATGTTTATCTA
rJMSF007J21+ AATACCCCACACCATCCCTCTCCTGCACCAATTAGCTGCTAAACACAACATGTTTATCTA
rJMFF011G17+ AATACCCCACACCATNCNTCTCCTGCACCAATTAGCTGNTNANCACAACATGNTTATGTA
rJMFF029O19+ AATACCCCACACCATCCCTCTCCTGCACCAATTAGCTGCTAAACACAACATGTTTATCTA
                      ____________________________________________________________
consensus AATACCCCACACCATCCCTCTCCTGCACCAATTAGCTGCTAAACACAACATGTTTATCTA
 
. : . : . : . : . : . :
rJMSF050D24+ GATTGTGTCCAGTCTCATCTGCATTGTATTGTTCATCCTTTATAATCCTTTTGATTAC
rJMSF008J21+ GATTGTGTCCAGTCTCATCTGCATTGTATTGTTCATCCTTTATAATCCTTTTGATTACTG
rJMFF035C15+ GATTGTGTCCAGTCTCATCTGCATTGTATTGTTCATCCTTTATAATCCTTTTGATTACTG
rJMSF007J21+ GATTGTGTCCAGTCTCATCTGCATTGTATTGTTCATCCTTTATAATCCTTTTGATTACTG
rJMFF011G17+ GATTGTNTCCAGTNTCATCNGCATNGTATTGTTCATCCNTTATNATCCTTNTGATTNCTG
rJMFF029O19+ GATTGTGTCCAGTCTCATCTGCATTGTATTGTTCATCCTTTATAATCCTTTTGATTACTG
                      ____________________________________________________________
consensus GATTGTGTCCAGTCTCATCTGCATTGTATTGTTCATCCTTTATAATCCTTTTGATTACTG
 
. : . : . : . : . : . :
rJMSF008J21+ TAATATTAATGAGACTATCAGTGGTAGGCTTCGTTGTTACTTGTTAGGATNTTACCTTTA
rJMFF035C15+ TAATATTAATGAGACTATCAGTGGTAGGCTTCGTTGTTACTTGTTAGGATATTACCTTTA
rJMSF007J21+ TAATATTAATGAGACTATCAGTGGTAGGCTTCGTTGTTACTTGTTAGGATATTACCTTTA
rJMFF011G17+ TAATANTAATGAGANNATCAGTGGTAGGCTTCGTTGTTACTTGNTAGGATANTACCNTNA
rJMFF029O19+ TAATATTAATGAGACTATCAGTGGTAGGCTTCGTTGTTACTTGTTAGGATATTACCTTTA
                      ____________________________________________________________
consensus TAATATTAATGAGACTATCAGTGGTAGGCTTCGTTGTTACTTGTTAGGATATTACCTTTA
 
. : . : . : . : . : . :
rJMSF008J21+ TAGGACTTTCTATGTTTCTGCCATACGCCAGCTATTGTGAACTTATGTGTTTGTAGGTAG
rJMFF035C15+ TAGGACTTTCTATGTTTCTGCCATA
rJMSF007J21+ TAGGACTTTCTATGTTTCTGCCATA-GCCAGCTA-TGTGAACTTATGTGTTTGTA-GTAG
rJMFF011G17+ TAGGACT
rJMFF029O19+ TAGGACTTTCTATGTTTCTGCCATA-GCCAGCTA-TGTGAACTTATGTGTTTGTA-GTAG
                      ____________________________________________________________
consensus TAGGACTTTCTATGTTTCTGCCATA-GCCAGCTA-TGTGAACTTATGTGTTTGTA-GTAG
 
. : . : . : . : . : . :
rJMSF008J21+ ATATACTGAC
rJMSF007J21+ ATATACTGAC
rJMFF029O19+ ATATACTGACTTGCAATACTTGTGCATGTTTGTGTTCAAGAATTGGCTTTGTTCCGTTGA
                      ____________________________________________________________
consensus ATATACTGACTTGCAATACTTGTGCATGTTTGTGTTCAAGAATTGGCTTTGTTCCGTTGA