Previous Contig 009611:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003I12Sequence558002303 (3)gb:AY150376_15849414e-64Arabidopsis thaliana putative formamidase (At4g37560) mRNA, complete cds.625009611 (3)pir|T04712|T047124e-84probable formamidase (EC 3.5.1.49) F19F18.40 - Arabidopsis thaliana>gb:ATCHRIV87
JMFF029O15Sequence695009611 (3)pir|T04712|T047126e-78probable formamidase (EC 3.5.1.49) F19F18.40 - Arabidopsis thaliana>gb:ATCHRIV87
JMSF027G03Sequence681009611 (3)gb:AY150376_15849419e-47Arabidopsis thaliana putative formamidase (At4g37560) mRNA, complete cds.715023272gb:AY087998_15730224e-23Arabidopsis thaliana clone 40250 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027G03+ GAAATAATTTAGATAAATTAATATAAGA
                      ____________________________________________________________
consensus GAAATAATTTAGATAAATTAATATAAGA
 
. : . : . : . : . : . :
JMSF027G03+ ACACATTCAAGACAGATAATGGTCAAAATTGGGTGAAAATGATATGGTTACATTAAAATC
                      ____________________________________________________________
consensus ACACATTCAAGACAGATAATGGTCAAAATTGGGTGAAAATGATATGGTTACATTAAAATC
 
. : . : . : . : . : . :
JMSF027G03+ ATTTTCCAATCAACATCTAAAATACAACATTAATTTGTCTACCACCCTTAGTATTGTCAG
                      ____________________________________________________________
consensus ATTTTCCAATCAACATCTAAAATACAACATTAATTTGTCTACCACCCTTAGTATTGTCAG
 
. : . : . : . : . : . :
JMSF027G03+ CTAGATGCACAGACACTTGTCAAGCATATTGCAACATTTCATGAATCAAAGTAATCTTGA
                      ____________________________________________________________
consensus CTAGATGCACAGACACTTGTCAAGCATATTGCAACATTTCATGAATCAAAGTAATCTTGA
 
. : . : . : . : . : . :
JMSF027G03+ AAATAAGCCAAAAGTAAAAATAGGATAAAGGCCATATGCATTGCTGTTTAATAATGGACC
                      ____________________________________________________________
consensus AAATAAGCCAAAAGTAAAAATAGGATAAAGGCCATATGCATTGCTGTTTAATAATGGACC
 
. : . : . : . : . : . :
JMSF027G03+ TGCTTCCACCAATAAGATCTCATCTAGTTTTGTTCTGATATTTCTCAGATGTGAAATAAT
rJMFF003I12+ CTCAAATGTGAAATAAT
rJMFF029O15+ GAAATAAT
                      ____________________________________________________________
consensus TGCTTCCACCAATAAGATCTCATCTAGTTTTGTTCTGATATTTCTCAGATGTGAAATAAT
 
. : . : . : . : . : . :
JMSF027G03+ AAGAAATGGTATGAAAGAGTACCTCACTCCAATGGGTCCTACTACCCTGCATGTCAACCC
rJMFF003I12+ AAGAAATGGTATGAAAGAGTACCTCACTCCAATGGGTCCTACTACCCTGCATGTCAACCC
rJMFF029O15+ AAGAAATGGTATGAAAGAGTACCTCACTCCAATGGGTCCTACTACCCTGCATGTCAACCC
                      ____________________________________________________________
consensus AAGAAATGGTATGAAAGAGTACCTCACTCCAATGGGTCCTACTACCCTGCATGTCAACCC
 
. : . : . : . : . : . :
JMSF027G03+ AATATTTGAGATAGGCCCAGTTGAGCCAAGGTTCTCAGAGTGGTTGGTGTTTGAAGGCAT
rJMFF003I12+ AATATTTGAGATAGGCCCAGTTGAGCCAAGGTTCTCAGAGTGGTTGGTGTTTGAAGGCAT
rJMFF029O15+ AATATTTGAGATAGGCCCAGTTGAGCCAAGGTTCTCAGAGTTGTTGGTGTTTGAAGGCAT
                      ____________________________________________________________
consensus AATATTTGAGATAGGCCCAGTTGAGCCAAGGTTCTCAGAGTGGTTGGTGTTTGAAGGCAT
 
. : . : . : . : . : . :
JMSF027G03+ CAGTGTTGATGAGAGTGGACAGCAGCACTATCTTGATGCCAGTGTTGCTTACAAGCGTGC
rJMFF003I12+ CAGTGTTGATGAGAGTGGACAGCAGCACTATCTTGATGCCAGTGTTGCTTACAAGCGTGC
rJMFF029O15+ CAGTGTTGATGAGAGTGGACAGCAGCACTATCTTGATGCCAGTGTTGCTTACAAGCGTGC
                      ____________________________________________________________
consensus CAGTGTTGATGAGAGTGGACAGCAGCACTATCTTGATGCCAGTGTTGCTTACAAGCGTGC
 
. : . : . : . : . : . :
JMSF027G03+ AGTGCTCAACGCAATTGATTAC
rJMFF003I12+ AGTGCTCAACGCAATTGATTACCTGTCAAAATTTGGCTACTCTAAGGAGCAGGTATATCT
rJMFF029O15+ AGTGCTCAACGCAATTGATTACCTGTCAAAATTTGGCTACTCTAAGGAGCAGGTATATCT
                      ____________________________________________________________
consensus AGTGCTCAACGCAATTGATTACCTGTCAAAATTTGGCTACTCTAAGGAGCAGGTATATCT
 
. : . : . : . : . : . :
rJMFF003I12+ CTTACTCTCATGCTGCCCTTGCGAAGGACGGATTTCAGGAATAGTTGATTCCCCCAATGC
rJMFF029O15+ CTTACTCTCATGCTGCCCTTGCGAAGGACGGATTTCAGGAAT--TTGATTCCCCCAATGC
                      ____________________________________________________________
consensus CTTACTCTCATGCTGCCCTTGCGAAGGACGGATTTCAGGAATAGTTGATTCCCCCAATGC
 
. : . : . : . : . : . :
rJMFF003I12+ TGTTGCCACACTAGCAATTCCCACTGCCATTTTTGACCAGG
rJMFF029O15+ TGTTGCCACACTAGCAATTCCCACTGCCATTTTTGACCAGGACATTCGTCCAAAAAACAA
                      ____________________________________________________________
consensus TGTTGCCACACTAGCAATTCCCACTGCCATTTTTGACCAGGACATTCGTCCAAAAAACAA
 
. : . : . : . : . : . :
rJMFF029O15+ CAAAGTTCCTGTAGGACCCCGGCTAGTGAGGAATCCAGGACTGCCACAGTGTACTTATGA
                      ____________________________________________________________
consensus CAAAGTTCCTGTAGGACCCCGGCTAGTGAGGAATCCAGGACTGCCACAGTGTACTTATGA
 
. : . : . : . : . : . :
rJMFF029O15+ TGGAGACTTGCCAATTACTAAAAATCCATGTGCTTCAACATAAATACACTATTAAAAAGC
                      ____________________________________________________________
consensus TGGAGACTTGCCAATTACTAAAAATCCATGTGCTTCAACATAAATACACTATTAAAAAGC
 
. : . : . : . : . : . :
rJMFF029O15+ AACTGGAAAGTAGCAGAGCATTATATACTAGCTAAACATACTTAAATGAAACATGTAGAA
                      ____________________________________________________________
consensus AACTGGAAAGTAGCAGAGCATTATATACTAGCTAAACATACTTAAATGAAACATGTAGAA
 
. : . : . : . : . : . :
rJMFF029O15+ ATAAATTTGACAGTGTAAGTTGAAAGCAACACTCCCTTGGATGCATTTAGTTATAAACAT
                      ____________________________________________________________
consensus ATAAATTTGACAGTGTAAGTTGAAAGCAACACTCCCTTGGATGCATTTAGTTATAAACAT