Previous Contig 009603:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021M13Sequence126001093 (2)721009603 (2)gb:OSJN00017_16933451e-79Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0017I01, complete seque
JMFF029L12Sequence126001093 (2)703009603 (2)gb:OSJN00017_16933457e-63Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0017I01, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF021M13+ GCTACAGCAGGGACGGAAAGAGAGTTG
                      ____________________________________________________________
consensus GCTACAGCAGGGACGGAAAGAGAGTTG
 
. : . : . : . : . : . :
rJMFF021M13+ GTTTATACNTACCAAATTAGCTACCAACCTCTCAATTAGCTTGGCAGATACATCATCAAG
                      ____________________________________________________________
consensus GTTTATACNTACCAAATTAGCTACCAACCTCTCAATTAGCTTGGCAGATACATCATCAAG
 
. : . : . : . : . : . :
rJMFF021M13+ GAAAGAGGGATTTGTTGTTGTGGAAACAAACTTCAGGATGTACGCGTATTCCTCATCAAA
rJMFF029L12+ TTGTGGAAACAAACTTCAGGATGTACGCGTATTCCTCATCAAA
                      ____________________________________________________________
consensus GAAAGAGGGATTTGTTGTTGTGGAAACAAACTTCAGGATGTACGCGTATTCCTCATCAAA
 
. : . : . : . : . : . :
rJMFF021M13+ ATTACATTGTGAGATCCTGCGCCTTTTTGCTAGAGTGGAGTACCAGCTTCCGAATCTCAT
rJMFF029L12+ ATTACATTGTGAGATCCTGCGCCTTTTTGCTAGAGTGGAGTACCAGCTTCCGAATCTCAT
                      ____________________________________________________________
consensus ATTACATTGTGAGATCCTGCGCCTTTTTGCTAGAGTGGAGTACCAGCTTCCGAATCTCAT
 
. : . : . : . : . : . :
rJMFF021M13+ TGTTGGTGCTATTACAAAAGAAAGCTTGTACAAAGCTTTTCAAAACGGCATAAGTGCTGA
rJMFF029L12+ TGTTGGTGCTATTACAAAAGAAAGCTTGTACAAAGCTTTTCAAAACGGCATAAGTGCTGA
                      ____________________________________________________________
consensus TGTTGGTGCTATTACAAAAGAAAGCTTGTACAAAGCTTTTCAAAACGGCATAAGTGCTGA
 
. : . : . : . : . : . :
rJMFF021M13+ GCAGATAATTTCTTTCTGTCAGCAGAACGCACATCCAAGGGTTGCCGAGAGAATACCAGC
rJMFF029L12+ GCAGATAATTTCTTTCTGTCAGCAGAACGCACATCCAAGGGTTGCCGAGAGAATACCAGC
                      ____________________________________________________________
consensus GCAGATAATTTCTTTCTGTCAGCAGAACGCACATCCAAGGGTTGCCGAGAGAATACCAGC
 
. : . : . : . : . : . :
rJMFF021M13+ CGTTCCAGAAAACGTCACTGACCAGATTAGGTTGTGGGAATCCGATCTGAACAGGGTTGA
rJMFF029L12+ CGTTCCAGAAAACGTCACTGACCAGATTAGGTTGTGGGAATCCGATCTGAACAGGGTTGA
                      ____________________________________________________________
consensus CGTTCCAGAAAACGTCACTGACCAGATTAGGTTGTGGGAATCCGATCTGAACAGGGTTGA
 
. : . : . : . : . : . :
rJMFF021M13+ AATGATGCCAGCCCATCTTTACGAGGAATTCCCCTCGAGAGACGCCTTTGAGGCTGCTTG
rJMFF029L12+ AATGATGCCAGCCCATCTTTACGAGGAATTCCCCTCGAGAGACGCCTTTGAGGCTGCTTG
                      ____________________________________________________________
consensus AATGATGCCAGCCCATCTTTACGAGGAATTCCCCTCGAGAGACGCCTTTGAGGCTGCTTG
 
. : . : . : . : . : . :
rJMFF021M13+ CGATTTTGCACGAGAATATGGAGGATTGCTGTGGGAGGACTCTAAGCGAATGCGAATCGT
rJMFF029L12+ CGATTTTGCACGAGAATATGGAGGATTGCTGTGGGAGGACTCTAAGCGAATGCGAATCGT
                      ____________________________________________________________
consensus CGATTTTGCACGAGAATATGGAGGATTGCTGTGGGAGGACTCTAAGCGAATGCGAATCGT
 
. : . : . : . : . : . :
rJMFF021M13+ GGTGAAGGCAGAAATTCTTGCTAACATGAAAGAGTTCCTTCGTCGAAAGCAATAATCAGT
rJMFF029L12+ GGTGAAGGCAGAAATTCTTGCTAACATGAAAGAGTTCCTTCGTCGAAAGCAATAATCAGT
                      ____________________________________________________________
consensus GGTGAAGGCAGAAATTCTTGCTAACATGAAAGAGTTCCTTCGTCGAAAGCAATAATCAGT
 
. : . : . : . : . : . :
rJMFF021M13+ TGTGTCTTCCCTCAATATTTATGAGAGTTTAAGGTTAGATTGTTTCTTTGTGCAATGTTT
rJMFF029L12+ TGTGTCTTCCCTCAATATTTATGAGAGTTTAAGGTTAGATTGTTTCTTTGTGCAATGTTT
                      ____________________________________________________________
consensus TGTGTCTTCCCTCAATATTTATGAGAGTTTAAGGTTAGATTGTTTCTTTGTGCAATGTTT
 
. : . : . : . : . : . :
rJMFF021M13+ TGTTCAAGTGGAAGTATGTGGGAATTTTGACAGTCTACATTCGACATAACATAATATATA
rJMFF029L12+ TGTTCAAGTGGAAGTATGTGGGAATTTTGACAGTCTACATTCGACATAACATAATATATA
                      ____________________________________________________________
consensus TGTTCAAGTGGAAGTATGTGGGAATTTTGACAGTCTACATTCGACATAACATAATATATA
 
. : . : . : . : . : . :
rJMFF021M13+ TACATATATGTCATAACCATGTATACATATCATT
rJMFF029L12+ TACATATATGTCATAACCATGTATACATATCATTTGATAGTGAAAAATTAGTCAAATAGC
                      ____________________________________________________________
consensus TACATATATGTCATAACCATGTATACATATCATTTGATAGTGAAAAATTAGTCAAATAGC
 
. : . : . : . : . : . :
rJMFF029L12+ AAAACACAACTCAAAGTTATGAACTATTGATCGTTTCCACTATCAAAAAGTTCTAAAATA
                      ____________________________________________________________
consensus AAAACACAACTCAAAGTTATGAACTATTGATCGTTTCCACTATCAAAAAGTTCTAAAATA