Previous Contig 009599:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026D20Sequence516004238 (11)gb:ATAC015985_15435750.004Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc723009599 (9)gb:AP005097_18477442e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMFF026F16Sequence605009599 (9)gb:AP005097_18477446e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMFF029K06Sequence515004238 (11)gb:ATAC015985_15435750.005Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc782009599 (9)gb:AP005097_18477442e-31Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMFF031C07Sequence517004238 (11)gb:ATAC015985_15435750.004Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc641009599 (9)gb:AP005097_18477443e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMFF050P22Sequence619004238 (11)gb:ATAC015985_15435753e-04Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc618009599 (9)gb:AP005097_18477444e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMFN008F20Sequence627009599 (9)gb:AP005097_18477448e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMSF003F05Sequence415004238 (11)757009599 (9)gb:AP005097_18477441e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMSF020D05Sequence667004238 (11)gb:ATAC015985_15435750.002Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc766009599 (9)gb:AP005097_18477443e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111
JMSF036H02Sequence669004238 (11)gb:ATAC015985_15435754e-05Arabidopsis thaliana chromosome III BAC F8A24 genomic sequence, complete sequenc609009599 (9)gb:AP005097_18477442e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:B111

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026D20+ CGTATCATTTATATCAAG
                      ____________________________________________________________
consensus CGTATCATTTATATCAAG
 
. : . : . : . : . : . :
rJMFF026F16+ GTGA
rJMFF031C07+ AATCACTGAATCAACCGAGTCAAGTGA
JMFN008F20- TTCCGAGAAAGTTGAGCTGAAAATCACTGAATCAACCGAGTCAAGTGA
rJMFF026D20+ TGGTATAATGAGTTCCGAGAAAGTTGAGCTGAAAATCACTGAATCAACCGAGTCAAGTGA
                      ____________________________________________________________
consensus TGGTATAATGAGTTCCGAGAAAGTTGAGCTGAAAATCACTGAATCAACCGAGTCAAGTGA
 
. : . : . : . : . : . :
rJMFF026F16+ CAGCTGCCATGAAAAGAAATGTGTATCAAGCTCAACAAACTATGGTGCATTCGAGCTGCA
rJMSF036H02+ GCTGCCATGAAAAGAAATGTGTATCAAGCTCANCAAACTATGGTGCATTCGAGCTGCA
rJMFF031C07+ CAGCTGCCATGAAAAGAAATGTGTATCAAGCTCAACAAACTATGGTGCATTCGAGCTGCA
JMFN008F20- CAGCTGCCATGAAAAGAAATGTGTATCAAGCTCAACAAACTATGGTGCATTCGAGCTGCA
rJMFF026D20+ CAGCTGCCATGAAAAGAAATGTGTATCAAGCTCAACAAACTATGGTGCATTCGAGCTGCA
rJMSF003F05+ CA
rJMSF020D05+ GCTGCA
rJMFF029K06+ CA
                      ____________________________________________________________
consensus CAGCTGCCATGAAAAGAAATGTGTATCAAGCTCAACAAACTATGGTGCATTCGAGCTGCA
 
. : . : . : . : . : . :
rJMFF026F16+ CACAACCGGTTTTGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
rJMSF036H02+ CACAACCGGTTTTGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
rJMFF031C07+ CACAACCGGTTTTGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
JMFN008F20- CACAACCGGTTTTGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
rJMFF026D20+ CACAACCGGTTTTGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
rJMFF050P22+ CCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGG-TTAGG
rJMSF003F05+ CACAACCGGTTT-GGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
rJMSF020D05+ CACAACCGGTTTNGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
rJMFF029K06+ CACANCCGGTTTGGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
                      ____________________________________________________________
consensus CACAACCGGTTTTGGCTCCAAGATGATGGTCAAGATGGGCTTCACTGGCGGAGGTTTAGG
 
. : . : . : . : . : . :
rJMFF026F16+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMSF036H02+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMFF031C07+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
JMFN008F20- AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMFF026D20+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMFF050P22+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMSF003F05+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMSF020D05+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
rJMFF029K06+ AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
                      ____________________________________________________________
consensus AAAGGATGGACAGGGTATTGCGGAGCCCATCCAAGTTTCTCAACGCCCTAAAGCACTTGG
 
. : . : . : . : . : . :
rJMFF026F16+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAANGAAACAAAGACTCCCACTCCTAA
rJMSF036H02+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
rJMFF031C07+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
JMFN008F20- TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
rJMFF026D20+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCNTAA
rJMFF050P22+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
rJMSF003F05+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
rJMSF020D05+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
rJMFF029K06+ TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCNTAA
                      ____________________________________________________________
consensus TTTGGGAGCTGACGTCCCTGAAACAAGCACTGCTAACGAAACAAAGACTCCCACTCCTAA
 
. : . : . : . : . : . :
rJMFF026F16+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMSF036H02+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMFF031C07+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
JMFN008F20- ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMFF026D20+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMFF050P22+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMSF003F05+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMSF020D05+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
rJMFF029K06+ ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
                      ____________________________________________________________
consensus ATCGGTTGGCTTTGGCGAGGATCTCCCTACAAGAAGCAGGAAATCAGGTAAAAAAGGATC
 
. : . : . : . : . : . :
rJMFF026F16+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMSF036H02+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMFF031C07+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
JMFN008F20- TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMFF026D20+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMFF050P22+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMSF003F05+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMSF020D05+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
rJMFF029K06+ TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
                      ____________________________________________________________
consensus TCAAGGCCAAAAAGCCCAGTACGGTTCTCCAGGATTTGGATCGTTCGAGAATCACACAAA
 
. : . : . : . : . : . :
rJMFF026F16+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMSF036H02+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMFF031C07+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
JMFN008F20- AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMFF026D20+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMFF050P22+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMSF003F05+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMSF020D05+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
rJMFF029K06+ AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
                      ____________________________________________________________
consensus AGGTTTTGGATCCAAGATGATGGCGAAGATGGGTTTCGTTGAAGGCACAGGACTTGGTAA
 
. : . : . : . : . : . :
rJMFF026F16+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMSF036H02+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMFF031C07+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
JMFN008F20- AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMFF026D20+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMFF050P22+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMSF003F05+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMSF020D05+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
rJMFF029K06+ AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
                      ____________________________________________________________
consensus AGATTCGCAAGGCATCACCGCCCCTATACTCGCAACACGTCGTCCTAAATCACAAGGGCT
 
. : . : . : . : . : . :
rJMFF026F16+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMSF036H02+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMFF031C07+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
JMFN008F20- GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMFF026D20+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMFF050P22+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMSF003F05+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMSF020D05+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
rJMFF029K06+ GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
                      ____________________________________________________________
consensus GGGTGCCAAATGATGATTTATGGTGTCATTTCATTCTTTGAGTTCTAGGGAAAAGCTTTT
 
. : . : . : . : . : . :
rJMFF026F16+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
rJMSF036H02+ CCCACTATGATGTTAGCNTATGGTTACTTTAGCTATCAGTNATCAGTGTTATAAGTAGTT
rJMFF031C07+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
JMFN008F20- CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAG
rJMFF026D20+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
rJMFF050P22+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
rJMSF003F05+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
rJMSF020D05+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
rJMFF029K06+ CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
                      ____________________________________________________________
consensus CCCACTATGATGTTAGCTTATGGTTACTTTAGCTATCAGTTATCAGTGTTATAAGTAGTT
 
. : . : . : . : . : . :
rJMSF036H02+ CT
rJMFF031C07+ CTTAACAATTTCTG
rJMFF026D20+ CTTAACAATTTCTGGTTTCACTTTCTCC-TTAAAATAAAGATT
rJMFF050P22+ CTTAACAATTTCTGGTTTCACTTTCTCCTTTAAAATAAAGATTTCAATATGGATGTTA
rJMSF003F05+ CTTAACAATTTCTGGTTTCACTTTCTCCTTTAAAATAAAGATTTCAATATGGATGTTAGC
rJMSF020D05+ CTTAACAATTTCTGGTTTCACTTTCTCCTTTAAAATAAAGATTTCAATATGGATGTTAGC
rJMFF029K06+ CTTAACAATTTCTGGTTTCACTTTCTCCTTTAAAATAAAGATTTCAATATGGATGTTAGC
                      ____________________________________________________________
consensus CTTAACAATTTCTGGTTTCACTTTCTCCTTTAAAATAAAGATTTCAATATGGATGTTAGC
 
. : . : . : . : . : . :
rJMSF003F05+ TTGCAGAGTTCATGAACTATGCTGGACAAGCATAATGTTGGGAGATGTTTATTAGCAGCA
rJMSF020D05+ TTGCAGAGTTCATGAACTATGCTGGACAAGCATAATGTTGGGAGATGTTTATTAGCAGCA
rJMFF029K06+ TTGCAGAGTTCATGAACTATGCTGGACAAGCATAATGTTGGGAGATGTTTATTAGCAGCA
                      ____________________________________________________________
consensus TTGCAGAGTTCATGAACTATGCTGGACAAGCATAATGTTGGGAGATGTTTATTAGCAGCA
 
. : . : . : . : . : . :
rJMSF003F05+ AAATGATCTTCCTCTGTGATTGGAAGTGGTTGTGCTAATGAACCCCCAAGACCCATCACT
rJMSF020D05+ AAATGATCTTCCTCTGTGATTGGAAGTGGTTGTGCTAATGAACCCCCAAGACCCATCACT
rJMFF029K06+ AAATGATCTTCCTCTGTGATTGGAAGTGGTTGTGCTAATGAACCCCCAAGACCCATCACT
                      ____________________________________________________________
consensus AAATGATCTTCCTCTGTGATTGGAAGTGGTTGTGCTAATGAACCCCCAAGACCCATCACT
 
. : . : . : . : . : . :
rJMSF003F05+ GTACACTCTTTGCACTTTGTGGCAAGAATTGAACTC
rJMSF020D05+ GTACACTCTTTGCACTTTGTGGCAAGAATTGAACTC
rJMFF029K06+ GTACACTCTTTGCACTTTGTGGCAAGAATTGAACTCTTACACTGTTGCTGGAATTAAGTT
                      ____________________________________________________________
consensus GTACACTCTTTGCACTTTGTGGCAAGAATTGAACTCTTACACTGTTGCTGGAATTAAGTT