Previous Contig 009588:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029G11Sequence618009588 (2)747009588 (2)pir|T48051|T480519e-14hypothetical protein F26K9.50 - Arabidopsis thaliana>gb:ATF26K9_1550109 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF029G11- ATTGTTAGAAAAAAGTCCAGCCTGTCTTGGAACTCTGAAAGTGATAGAAGAGGGTA
                      ____________________________________________________________
consensus ATTGTTAGAAAAAAGTCCAGCCTGTCTTGGAACTCTGAAAGTGATAGAAGAGGGTA
 
. : . : . : . : . : . :
JMFF029G11- TATCAACCCACCCATGTCGTATCCCGGACTCGATTCGGGTCGGGTCGTTCAATTCTCAGG
                      ____________________________________________________________
consensus TATCAACCCACCCATGTCGTATCCCGGACTCGATTCGGGTCGGGTCGTTCAATTCTCAGG
 
. : . : . : . : . : . :
JMFF029G11- TATTTACTACTGCCGATTCACTCGTCCCTTAGCTCCCGCCATAGCTAAATGAAGTCGAGA
                      ____________________________________________________________
consensus TATTTACTACTGCCGATTCACTCGTCCCTTAGCTCCCGCCATAGCTAAATGAAGTCGAGA
 
. : . : . : . : . : . :
JMFF029G11- CTTGCAGCTTCAATATCATTCCTGCCTGGTGCTCGTTCAAATAACATTTGCAGAACATGG
                      ____________________________________________________________
consensus CTTGCAGCTTCAATATCATTCCTGCCTGGTGCTCGTTCAAATAACATTTGCAGAACATGG
 
. : . : . : . : . : . :
JMFF029G11- AAAGCGTTTAACTTTGGATTGACCAGTATACAACATGGGAGCTCAAATGGCTCGATACAC
                      ____________________________________________________________
consensus AAAGCGTTTAACTTTGGATTGACCAGTATACAACATGGGAGCTCAAATGGCTCGATACAC
 
. : . : . : . : . : . :
JMFF029G11- AGCTCCTCGATGGAAGATGACAGCTTTGCAGAATTGGGTCCTCCGGTGACTGAAAGAGCC
                      ____________________________________________________________
consensus AGCTCCTCGATGGAAGATGACAGCTTTGCAGAATTGGGTCCTCCGGTGACTGAAAGAGCC
 
. : . : . : . : . : . :
JMFF029G11- GTTTCACAACTGAAATTGGCAACAGAGAAACCCGAACATTTCATATGGAAAAATAAATCT
rJMFF029G11+ CATTTCATATGGAAAAATAAATCT
                      ____________________________________________________________
consensus GTTTCACAACTGAAATTGGCAACAGAGAAACCCGAACATTTCATATGGAAAAATAAATCT
 
. : . : . : . : . : . :
JMFF029G11- GCAAGAAAAATGTCATCCAAAAATGAAGACAAGAACCACAAAAAGGGAACTGTCTCAAGT
rJMFF029G11+ GCAAGAAAAATGTCATCCAAAAATGAAGACAAGACCCACAAAAAGGGAACTGTCTCAAGT
                      ____________________________________________________________
consensus GCAAGAAAAATGTCATCCAAAAATGAAGACAAGACCCACAAAAAGGGAACTGTCTCAAGT
 
. : . : . : . : . : . :
JMFF029G11- CGCGAGAAATCCTGTCAAAGCATAGCTGAGCCTGTGGATGCTTCCAATGCAAGTAGTTCA
rJMFF029G11+ CGCGAGAAATCCTGTCAAAGCATAGCTGAGCCTGTGGATGCTTCCAATGCAAGTAGTTCA
                      ____________________________________________________________
consensus CGCGAGAAATCCTGTCAAAGCATAGCTGAGCCTGTGGATGCTTCCAATGCAAGTAGTTCA
 
. : . : . : . : . : . :
JMFF029G11- ACTGACACAATTAGAATCCAAGGNATCGATGACCATGCATCCATTCATGACATACATTCA
rJMFF029G11+ ACTGACACAATTAGAATCCAAGGCATCGATGACCATGCATCCATTCATGACATACATTCA
                      ____________________________________________________________
consensus ACTGACACAATTAGAATCCAAGGCATCGATGACCATGCATCCATTCATGACATACATTCA
 
. : . : . : . : . : . :
JMFF029G11- CTCTGCAAAACGCTTGGCAATT
rJMFF029G11+ CTCTGCAAAACGCTTGGCAATTTAGATGGATTGGAATGGGTAGGCAACGATGCTATAGAT
                      ____________________________________________________________
consensus CTCTGCAAAACGCTTGGCAATTTAGATGGATTGGAATGGGTAGGCAACGATGCTATAGAT
 
. : . : . : . : . : . :
rJMFF029G11+ GCATTCTTTACTGTGGCAAGTGAATCCGACTCTCAAAGAATACTCGAGAAGTTGAATGAT
                      ____________________________________________________________
consensus GCATTCTTTACTGTGGCAAGTGAATCCGACTCTCAAAGAATACTCGAGAAGTTGAATGAT
 
. : . : . : . : . : . :
rJMFF029G11+ ACAACTATTGGCAACAGCCACTTATCGGCATCTTTACTTTCAAGCAACTCTACTGCGTCC
                      ____________________________________________________________
consensus ACAACTATTGGCAACAGCCACTTATCGGCATCTTTACTTTCAAGCAACTCTACTGCGTCC
 
. : . : . : . : . : . :
rJMFF029G11+ AAGTCCATAAAAGAGATTGCTTTGCAGGAGAGAGGTCTACAATTTAGCACTAGCATTGAT
                      ____________________________________________________________
consensus AAGTCCATAAAAGAGATTGCTTTGCAGGAGAGAGGTCTACAATTTAGCACTAGCATTGAT
 
. : . : . : . : . : . :
rJMFF029G11+ GAACTCAGAAGGCAAATGGACTTGAAGCGGATTTACTTGGAGGATTTAGAGATGCTGCAT
                      ____________________________________________________________
consensus GAACTCAGAAGGCAAATGGACTTGAAGCGGATTTACTTGGAGGATTTAGAGATGCTGCAT
 
. : . : . : . : . : . :
rJMFF029G11+ CACGGGATAATGCACCTTCAATGTTTGCCAACTATGAGCGATTAACGTTTGTTACATCCA
                      ____________________________________________________________
consensus CACGGGATAATGCACCTTCAATGTTTGCCAACTATGAGCGATTAACGTTTGTTACATCCA
 
. : . : . : . : . : . :
rJMFF029G11+ CTCACAAACTTCCTTCCACCTCCTTCAAGGGCAAAAGTTGGTGGTTCATGATTTTGATAT
                      ____________________________________________________________
consensus CTCACAAACTTCCTTCCACCTCCTTCAAGGGCAAAAGTTGGTGGTTCATGATTTTGATAT
 
. : . : . : . : . : . :
rJMFF029G11+ AAAGCATTGCAGATTTGCAGGGTAATTGATAAAGACCAACATGGGTTCTTGTGTTTATGG
                      ____________________________________________________________
consensus AAAGCATTGCAGATTTGCAGGGTAATTGATAAAGACCAACATGGGTTCTTGTGTTTATGG
 
. : . : . : . : . : . :
rJMFF029G11+ AACTAGCACAACTTGAATGGTGTCATGACCACATGAACTATTTAATATTTGCAAAGAGAA
                      ____________________________________________________________
consensus AACTAGCACAACTTGAATGGTGTCATGACCACATGAACTATTTAATATTTGCAAAGAGAA