Previous Contig 009586:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029F24Sequence590009586 (2)gb:AB019230_15141521e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MEB5.598009586 (2)pir|E96525|E965259e-33protein T1N15.21 [imported] - Arabidopsis thaliana>gb:AE005173_892820 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF029F24- AGAGAAGTAAATTTAGTATTACTATTACGTAGAGACATACA
                      ____________________________________________________________
consensus AGAGAAGTAAATTTAGTATTACTATTACGTAGAGACATACA
 
. : . : . : . : . : . :
JMFF029F24- CGATTAACAGCTAGGGAATTGAAGGATTATTGGGGCCCAGTAAGAGATGGGTCCCCCGGG
                      ____________________________________________________________
consensus CGATTAACAGCTAGGGAATTGAAGGATTATTGGGGCCCAGTAAGAGATGGGTCCCCCGGG
 
. : . : . : . : . : . :
JMFF029F24- AATTAGAGTACCCATAGCATTGATTCACCGGCTCCGGCGTGGCAGAAGCGGTGGCAAAAG
                      ____________________________________________________________
consensus AATTAGAGTACCCATAGCATTGATTCACCGGCTCCGGCGTGGCAGAAGCGGTGGCAAAAG
 
. : . : . : . : . : . :
JMFF029F24- CGGAGGAAATGATGAGTCCCACAAGACGTCGGCGGAGGGGTCCAGCCACAAGAAGTCGTC
                      ____________________________________________________________
consensus CGGAGGAAATGATGAGTCCCACAAGACGTCGGCGGAGGGGTCCAGCCACAAGAAGTCGTC
 
. : . : . : . : . : . :
JMFF029F24- GGAAGGGTCCAGCCACAAGAAATCGTCGGAGGGGTCCAGCCACAAGAAGTCGGAGGGGTC
                      ____________________________________________________________
consensus GGAAGGGTCCAGCCACAAGAAATCGTCGGAGGGGTCCAGCCACAAGAAGTCGGAGGGGTC
 
. : . : . : . : . : . :
JMFF029F24- CGGCCACTGCCGCAGCGGCTCAGCCGGCAACAAGGTGGAGATGGACAGCCTCCTAGGCCT
                      ____________________________________________________________
consensus CGGCCACTGCCGCAGCGGCTCAGCCGGCAACAAGGTGGAGATGGACAGCCTCCTAGGCCT
 
. : . : . : . : . : . :
JMFF029F24- TCTCAAAGTTCGGATCAAACGAGGTATTAACCTGGCCGTGCGCGATGCTCGCAGTAGCGA
                      ____________________________________________________________
consensus TCTCAAAGTTCGGATCAAACGAGGTATTAACCTGGCCGTGCGCGATGCTCGCAGTAGCGA
 
. : . : . : . : . : . :
JMFF029F24- TCCTTACGTTATTGTCAAGATGGGTAAACAGAAGCTGAGGACTCATGTTTTGAAGAGGGA
rJMFF029F24+ CTTACGTTATTGTCAAGATGGGTAAACAGAAGCTGAGGACTCATGTTTTGAAGAGGGA
                      ____________________________________________________________
consensus TCCTTACGTTATTGTCAAGATGGGTAAACAGAAGCTGAGGACTCATGTTTTGAAGAGGGA
 
. : . : . : . : . : . :
JMFF029F24- TGTGAATCCTGAGTGGAATGAAGACCTGACCCTTTATGTTTCAGATCCCAGTCTTCCCAT
rJMFF029F24+ TGTGAATCNTGAGTGGAATGAAGACCTGACCCTTTATGTTTCAGATCCCAGTNTTCCCAT
                      ____________________________________________________________
consensus TGTGAATCCTGAGTGGAATGAAGACCTGACCCTTTATGTTTCAGATCCCAGTCTTCCCAT
 
. : . : . : . : . : . :
JMFF029F24- TAAAGTGACTGTGTATGATCATGATACATTTAGCATGGACGACAAAATGGGATATGCAGA
rJMFF029F24+ TAAAGTGACTGTGTATGATCATGATACATTTAGCATGGNCGACAAAATGGGATATGCAGA
                      ____________________________________________________________
consensus TAAAGTGACTGTGTATGATCATGATACATTTAGCATGGACGACAAAATGGGATATGCAGA
 
. : . : . : . : . : . :
JMFF029F24- AATCGATAT
rJMFF029F24+ AATCGATATCAAGCATNTANTAGAGGCCNTGAAGATGGATAATCATAATAACAGTGATGA
                      ____________________________________________________________
consensus AATCGATATCAAGCATNTANTAGAGGCCNTGAAGATGGATAATCATAATAACAGTGATGA
 
. : . : . : . : . : . :
rJMFF029F24+ GGAGAGAATAGTTGCAAGAGTTCCACCGGGGAGATCAAACTGCNTGGCTGCAGAATCCTG
                      ____________________________________________________________
consensus GGAGAGAATAGTTGCAAGAGTTCCACCGGGGAGATCAAACTGCNTGGCTGCAGAATCCTG
 
. : . : . : . : . : . :
rJMFF029F24+ CGTGGTTATCAAAGACGGGGAGGTCACACAGGATATGTGTNTCAGATTGAAGAACGTCGA
                      ____________________________________________________________
consensus CGTGGTTATCAAAGACGGGGAGGTCACACAGGATATGTGTNTCAGATTGAAGAACGTCGA
 
. : . : . : . : . : . :
rJMFF029F24+ GAGTGGTGAGGTTGATATCCAAATCCAGTGGATTAATCTCCCTTCTGGCTCCGAGCAGCA
                      ____________________________________________________________
consensus GAGTGGTGAGGTTGATATCCAAATCCAGTGGATTAATCTCCCTTCTGGCTCCGAGCAGCA
 
. : . : . : . : . : . :
rJMFF029F24+ GTCTTAATATATATACATTAATAATATATATTATTATAGTGGCGGAGCCACATATACAAT
                      ____________________________________________________________
consensus GTCTTAATATATATACATTAATAATATATATTATTATAGTGGCGGAGCCACATATACAAT
 
. : . : . : . : . : . :
rJMFF029F24+ GCATGGGGCCTTGCCCCCCTCCAATTTTTATTTTTGTTTCTTTATATTAATATTATAAGA
                      ____________________________________________________________
consensus GCATGGGGCCTTGCCCCCCTCCAATTTTTATTTTTGTTTCTTTATATTAATATTATAAGA
 
. : . : . : . : . : . :
rJMFF029F24+ TTTTATTTTATTTTTTGNTGCCAATTGCCCCCTTGTTTGGTTGGATGTAGTTTAGTTGTA
                      ____________________________________________________________
consensus TTTTATTTTATTTTTTGNTGCCAATTGCCCCCTTGTTTGGTTGGATGTAGTTTAGTTGTA