Previous Contig 009585:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029F01Sequence428009585 (2)gb:AL669947_20725890.040Mouse DNA sequence from clone RP23-434D24 on chromosome 1 Contains two novel gen747009585 (2)gb:AP003611_18313316e-17Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P042

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF029F01- ACTGTATGGACCAAAACGCCGTCGTAAACTTCC
                      ____________________________________________________________
consensus ACTGTATGGACCAAAACGCCGTCGTAAACTTCC
 
. : . : . : . : . : . :
JMFF029F01- GGCACGGCCACGGCCGATCCACCTCGACGGATCGGTTTCTCGGCGTGTTTTCGCCGCCGA
                      ____________________________________________________________
consensus GGCACGGCCACGGCCGATCCACCTCGACGGATCGGTTTCTCGGCGTGTTTTCGCCGCCGA
 
. : . : . : . : . : . :
JMFF029F01- AGGTGGAATCTGCTATTGGCGGCGGAGGGGAATCGGATGCATCCTTGGGCGGCGATGAGC
                      ____________________________________________________________
consensus AGGTGGAATCTGCTATTGGCGGCGGAGGGGAATCGGATGCATCCTTGGGCGGCGATGAGC
 
. : . : . : . : . : . :
JMFF029F01- TGAACGAAGACGATGTGCTTTGGACTGGACGAGACTTTACGGAGCCTCAACCTCGCTCCA
                      ____________________________________________________________
consensus TGAACGAAGACGATGTGCTTTGGACTGGACGAGACTTTACGGAGCCTCAACCTCGCTCCA
 
. : . : . : . : . : . :
JMFF029F01- ATTCAGGCTCTCTCAGCACTCCTCGGCAGGCGTTTAAGAAGCCGGAGAATTTTGGAATCC
rJMFF029F01+ TTAAGAAGCCGGAGANTTTTGGAATCC
                      ____________________________________________________________
consensus ATTCAGGCTCTCTCAGCACTCCTCGGCAGGCGTTTAAGAAGCCGGAGAATTTTGGAATCC
 
. : . : . : . : . : . :
JMFF029F01- TCGCCGCATTGCCGGAGCAGCAGCGGAAAGGTGGGCGTCCGGTTATCTATCAAAAGCACG
rJMFF029F01+ TCGCCGCATTGCCGGAGCAGCAGCGGAAAGGTGGGCGTCCGGTTATCTATCAAAAGCACG
                      ____________________________________________________________
consensus TCGCCGCATTGCCGGAGCAGCAGCGGAAAGGTGGGCGTCCGGTTATCTATCAAAAGCACG
 
. : . : . : . : . : . :
JMFF029F01- CTACGACGTCGTTTTCGCGGGATTTCCCTTCAATTCCCAAGCCCGCGGTGGACAGGGAGC
rJMFF029F01+ CTACGACGTCGTTTTCGCGGGATTTCCCTTCAATTCCCAAGCCCGCGGTGGACAGGGAGC
                      ____________________________________________________________
consensus CTACGACGTCGTTTTCGCGGGATTTCCCTTCAATTCCCAAGCCCGCGGTGGACAGGGAGC
 
. : . : . : . : . : . :
JMFF029F01- AGAGCTATGGCTACAATCGGAACTTCTCGCAATCA
rJMFF029F01+ AGAGCTATGGCTACAATCGGAACTTCTCGCAATCAATGCCGGCTACGAAGTTCCAGCACT
                      ____________________________________________________________
consensus AGAGCTATGGCTACAATCGGAACTTCTCGCAATCAATGCCGGCTACGAAGTTCCAGCACT
 
. : . : . : . : . : . :
rJMFF029F01+ CGGCTCCGATGAAAGTGCCGATGATGCCGAAGAAGGCGCCGAGGAACGGCGAGCTTGCTG
                      ____________________________________________________________
consensus CGGCTCCGATGAAAGTGCCGATGATGCCGAAGAAGGCGCCGAGGAACGGCGAGCTTGCTG
 
. : . : . : . : . : . :
rJMFF029F01+ ATGTGGACATTGACGACGACGACGGTGCCGATGATGAAATGCTGCCACCGCATGAGATCG
                      ____________________________________________________________
consensus ATGTGGACATTGACGACGACGACGGTGCCGATGATGAAATGCTGCCACCGCATGAGATCG
 
. : . : . : . : . : . :
rJMFF029F01+ TGGCGCGAGGATCGGCTAGGTCTCCGAAAACCACTTTCTCAGTACTGGAAGGAGTCGGCA
                      ____________________________________________________________
consensus TGGCGCGAGGATCGGCTAGGTCTCCGAAAACCACTTTCTCAGTACTGGAAGGAGTCGGCA
 
. : . : . : . : . : . :
rJMFF029F01+ GAACCCTCAAGGGGAGGGATCTTCGTCAGGTTCGCAATGCGGTTTTTCGTCAAACAGGTT
                      ____________________________________________________________
consensus GAACCCTCAAGGGGAGGGATCTTCGTCAGGTTCGCAATGCGGTTTTTCGTCAAACAGGTT
 
. : . : . : . : . : . :
rJMFF029F01+ TCATCGACTGAGAACAATTGAGACTGAACTCAAATTTTAGTCAAAGTCTGTGATTTTGCT
                      ____________________________________________________________
consensus TCATCGACTGAGAACAATTGAGACTGAACTCAAATTTTAGTCAAAGTCTGTGATTTTGCT
 
. : . : . : . : . : . :
rJMFF029F01+ CTTCCTTTTGACTGTGAAGTTAACAAGTTTTCCAGATAGCTTTCAGTCATGAAGTCGATT
                      ____________________________________________________________
consensus CTTCCTTTTGACTGTGAAGTTAACAAGTTTTCCAGATAGCTTTCAGTCATGAAGTCGATT
 
. : . : . : . : . : . :
rJMFF029F01+ CCCCCCAATTATAGTCAAATATAGTAGTATATGGAAATTTCATTTTTTTTGTCTGTGTTT
                      ____________________________________________________________
consensus CCCCCCAATTATAGTCAAATATAGTAGTATATGGAAATTTCATTTTTTTTGTCTGTGTTT
 
. : . : . : . : . : . :
rJMFF029F01+ ATGATTCTTATATTGTTGATTTTTTCTTGAAGATATTACATTGAAAATTTTGGTAAAACT
                      ____________________________________________________________
consensus ATGATTCTTATATTGTTGATTTTTTCTTGAAGATATTACATTGAAAATTTTGGTAAAACT
 
. : . : . : . : . : . :
rJMFF029F01+ TCCAGTATTGAACAGGAGAATTACAGACAGCTTTTGGGAGAAGATTCAATTCAAAGAAAC
                      ____________________________________________________________
consensus TCCAGTATTGAACAGGAGAATTACAGACAGCTTTTGGGAGAAGATTCAATTCAAAGAAAC