Previous Contig 009572:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029A14Sequence329014639766009572 (4)gb:AF503756_18067576e-76Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds
JMFS008H04Sequence598009572 (4)gb:AF503756_18067576e-82Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds
JMSF009C22Sequence319005062 (4)gb:AF503756_18067573e-04Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds778009572 (4)gb:AF503756_1806757e-109Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds
JMSF019D09Sequence225005062 (4)806009572 (4)gb:AF503756_18067577e-65Arabidopsis thaliana long chain acyl-CoA synthetase 6 (LACS6) mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009C22+ CAAGTCCAGCATGTGAAATCAAGCTTGTTGATGTTCCAGAGAT
rJMSF019D09+ AGTCCAGCATGGGAAATCCAGCTTGTTGATGTTCCAGAGAT
                      ____________________________________________________________
consensus CAAGTCCAGCATGTGAAATCCAGCTTGTTGATGTTCCAGAGAT
 
. : . : . : . : . : . :
rJMSF009C22+ GAATTATACATTTGAGGATCAACCTCATCCTCGTGGAGAGGTTTGTGTCAGGGGCCCCAT
rJMSF019D09+ GAATTATACATCTGAGGATCAACCTCATCCTCGTGGAGAGGTTTGTGTCAGGGGCCCCAT
                      ____________________________________________________________
consensus GAATTATACATTTGAGGATCAACCTCATCCTCGTGGAGAGGTTTGTGTCAGGGGCCCCAT
 
. : . : . : . : . : . :
JMFS008H04- GTTGACAAAGATGG
rJMSF009C22+ TGTTTTCCAAGGCTATTACAAAGATGAAGTGCAAACGAGAGAGGTAGTTGACAAAGATGG
rJMSF019D09+ TGTTTTCCAAGGCTATTACAAAGATGAAGTGCAAACGAGAGAGGTAGTTGACAAAGATGG
                      ____________________________________________________________
consensus TGTTTTCCAAGGCTATTACAAAGATGAAGTGCAAACGAGAGAGGTAGTTGACAAAGATGG
 
. : . : . : . : . : . :
JMFS008H04- TTGGCTACATACTGGAGATATTGGGTTGTGGTTACCTGGAGGCCGCTTGAAGATTATCGA
rJMSF009C22+ TTGGCTACATACTGGAGATATTGGGTTGTGGTTACCTGGAGGCCGCTTGAAGATTATCGA
rJMSF019D09+ TTGGCTACATACTGGAGATATTGGGTTGTGGTTACCTGGAGGCCGCTTGAAGATTATCGA
rJMFF029A14+ GGAGATATTGGGTTGTGGTTACCTGGAGGCCGCTTGAAGATTATCGA
                      ____________________________________________________________
consensus TTGGCTACATACTGGAGATATTGGGTTGTGGTTACCTGGAGGCCGCTTGAAGATTATCGA
 
. : . : . : . : . : . :
JMFS008H04- CAGGAAAAAGAACATATTTAAGTTGGCTCAGGGTGAATACATAGCTCCGGAGAAAATTGA
rJMSF009C22+ CAGGAAAAAGAACATATTTAAGTTGGCTCAGGGTGAATACATAGCTCCGGAGAAAATTGA
rJMSF019D09+ CAGG-AAAAGAACATATTTAAGTTGGCTCAGGGTGAATACATAGCTCCGGAGAAAATTGA
rJMFF029A14+ CAGGAAAAAGAACATATTTAAGTTGGCTCAGGGTGAATACATAGCTCCGGAGAAAATTGA
                      ____________________________________________________________
consensus CAGGAAAAAGAACATATTTAAGTTGGCTCAGGGTGAATACATAGCTCCGGAGAAAATTGA
 
. : . : . : . : . : . :
JMFS008H04- GAATGTTTATGCCAAGTGCAAATTTGTTGCACAATGCTTTGTATACGGTGATAGCTTGAA
rJMSF009C22+ GAATGTTTATGCCAAGTGCAAATTTGTTGCACAATGCTTTGTATACGGTGATAGCTTGAA
rJMSF019D09+ GAATGTTTATGCCAAGTGCAAATTTGTTGCACAATGCTTTGTATACGGTGATAGCTTGAA
rJMFF029A14+ GAATGTTTATGCCAAGTGCAAATTTGTTGCACAATGCTTTGTATACGGTGATAGCTTGAA
                      ____________________________________________________________
consensus GAATGTTTATGCCAAGTGCAAATTTGTTGCACAATGCTTTGTATACGGTGATAGCTTGAA
 
. : . : . : . : . : . :
JMFS008H04- CTCGTCTCTTGTATCTATAGTTTGTATAGATCCCGATGTGTTGAAGGAATGGGCTTCATC
rJMSF009C22+ CTCGTCTCTTGTATCTATAGTTTGTATAGATCCCGATGTGTTGAAGGAATGGGCTTCATC
rJMSF019D09+ CTCGTCTCTTGTATCTATAGTTTGTATAGATCCCGATGTGTTGAAGGAATGGGCTTCATC
rJMFF029A14+ CTCGTCTCTTGTATCTATAGTTTGTATAGATCCCGATGTGTTGAAGGAATGGGCTTCATC
                      ____________________________________________________________
consensus CTCGTCTCTTGTATCTATAGTTTGTATAGATCCCGATGTGTTGAAGGAATGGGCTTCATC
 
. : . : . : . : . : . :
JMFS008H04- TGAGGGCATTAAGTATGAAAGTTTGCAACAATTATGCAACGATCCGAGAGCCAAAGCTGC
rJMSF009C22+ TGAGGGCATTAAGTATGAAAGTTTGCAACAATTATGCAACGATCCGAGAGCCAAAGCTGC
rJMSF019D09+ TGAGGGCATTAAGTATGAAAGTTTGCAACAATTATGCAACGATCCGAGAGCCAAAGCTGC
rJMFF029A14+ TGAGGGCATTAAGTATGAAAGTTTGCAACAATTATGCAACGATCCGAGAGCCAAAGCTGC
                      ____________________________________________________________
consensus TGAGGGCATTAAGTATGAAAGTTTGCAACAATTATGCAACGATCCGAGAGCCAAAGCTGC
 
. : . : . : . : . : . :
JMFS008H04- CGTTCTAGCAGACATGGACGCCATAGGAAGGGAAGCTCAGTTGAGAGGCTTTGAATTCGC
rJMSF009C22+ CGTTCTAGCAGACATGGACGCCATAGGAAGGGAAGCTCAGTTGAGAGGCTTTGAATTCGC
rJMSF019D09+ CGTTCTAGCAGACATGGACGCCATAGGAAGGGAAGCTCAGTTGAGAGGCTTTGAATTCGC
rJMFF029A14+ CGTTCTAGCAGACATGGACGCCATAGGAAGGGAAGCTCAGTTGAGAGGCTTTGAATTCGC
                      ____________________________________________________________
consensus CGTTCTAGCAGACATGGACGCCATAGGAAGGGAAGCTCAGTTGAGAGGCTTTGAATTCGC
 
. : . : . : . : . : . :
JMFS008H04- AAAAGCTGTCACCTTAGTGGTCGAGCCTTTCACAGTCGAGAATGGTCTTCTTACACCCAC
rJMSF009C22+ AAAAGCTGTCACCTTAGTGGTCGAGCCTTTCACAGTCGAGAATGGTCTTCTTACACCCAC
rJMSF019D09+ AAAAGCTGTCACCTTAGTGGTCGAGCCTTTCACAGTCGAGAATGGTCTTCTTACACCCAC
rJMFF029A14+ AAAAGCTGTCACCTTAGTGGTCGAGCCTTTCACAGTCGAGAATGGTCTTCTTACACCCAC
                      ____________________________________________________________
consensus AAAAGCTGTCACCTTAGTGGTCGAGCCTTTCACAGTCGAGAATGGTCTTCTTACACCCAC
 
. : . : . : . : . : . :
JMFS008H04- ATTCAAGGTGAAGAGGCCACAGGCAAAAGCATACTTTGCACAAGCAATATCTGAAATGTA
rJMSF009C22+ ATTCAAGGTGAAGAGGCCACAGGCAAAAGCATACTTTGCACAAGCAATATCTGAAATGTA
rJMSF019D09+ ATTCAAGGTGAAGAGGCCACAGGCAAAAGCATACTTTGCACAAGCAATATCTGAAATGTA
rJMFF029A14+ ATTCAAGGTGAAGAGGCCACAGGCAAAAGCATACTTTGCACAAGCAATATCTGAAATGTA
                      ____________________________________________________________
consensus ATTCAAGGTGAAGAGGCCACAGGCAAAAGCATACTTTGCACAAGCAATATCTGAAATGTA
 
. : . : . : . : . : . :
JMFS008H04- CAATGAGCTGTCGAGATCCGATCCTGCGCAGAAAGTTCTATAGTCACCAAACACTCAAAC
rJMSF009C22+ CAATGAGCTGTCGAGATCCGATCCTGCGCAGAAAGTTCTATAGTCACCAAACACTCAAAC
rJMSF019D09+ CAATGAGCTGTCGAGATCCGATCCTGCGCAGAAAGTTCTATAGTCACCAAACACTCAAAC
rJMFF029A14+ CAATGAGCTGTCGAGATCCGATCCTGCGCAGAAAGTTCTATAGTCACCAAACACTCAAAC
                      ____________________________________________________________
consensus CAATGAGCTGTCGAGATCCGATCCTGCGCAGAAAGTTCTATAGTCACCAAACACTCAAAC
 
. : . : . : . : . : . :
JMFS008H04- TTTACCCTCTTATTTTAATAAACTAGTTACACCTTACTTAATTG
rJMSF009C22+ TTTACCCTCTTATTTTAATAAACTAGTTACACCTTACTTAATTGTTGTATTTGCAACTTC
rJMSF019D09+ TTTACCCTCTTATTTTAATAAACTAGTTACACCTTACTTAATTGTTGTATTTGCAACTTC
rJMFF029A14+ TTTACCCTCTTATTTTAATAAACTAGTTACACCTTACTTAATTGTTGTATTTGCAACTTC
                      ____________________________________________________________
consensus TTTACCCTCTTATTTTAATAAACTAGTTACACCTTACTTAATTGTTGTATTTGCAACTTC
 
. : . : . : . : . : . :
rJMSF009C22+ CAACAAAACAGCATT
rJMSF019D09+ CAACAAAACAGCATTTTATTTTTTATTTTTATAGGCCATGTGTATG
rJMFF029A14+ CAACAAAACAGCATTTTATTTTTTATTTTTATA-GCCATGTGTATGGGCTGTACCATTTT
                      ____________________________________________________________
consensus CAACAAAACAGCATTTTATTTTTTATTTTTATAGGCCATGTGTATGGGCTGTACCATTTT
 
. : . : . : . : . : . :
rJMFF029A14+ CGAAGAAAATATATATAGTGTTACAGTGAAGGTGATGGTTTTAATAATTCTAGCCTTAAT
                      ____________________________________________________________
consensus CGAAGAAAATATATATAGTGTTACAGTGAAGGTGATGGTTTTAATAATTCTAGCCTTAAT
 
. : . : . : . : . : . :
rJMFF029A14+ CAGGAATTTCCCTCCCTGAATAGAAATTCTATTTTTATTTTTTGAAATATNAAAAGTGAT
                      ____________________________________________________________
consensus CAGGAATTTCCCTCCCTGAATAGAAATTCTATTTTTATTTTTTGAAATATNAAAAGTGAT