Previous Contig 009570:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028P05Sequence490003240 (5)gb:AY054668_15633221e-07Arabidopsis thaliana putative protein (At4g37590; F19F18.80) mRNA, complete cds.620009570 (3)pir|T02594|T025941e-05hypothetical protein At2g14820 [imported] - Arabidopsis thaliana>gb:AC004705_153
JMSF003C09Sequence298002954 (3)445009570 (3)
JMSF016J15Sequence774009570 (3)pir|T02594|T025941e-31hypothetical protein At2g14820 [imported] - Arabidopsis thaliana>gb:AC004705_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF016J15+ CTGGGATCACTAAAAGTGAAAGGAAA
                      ____________________________________________________________
consensus CTGGGATCACTAAAAGTGAAAGGAAA
 
. : . : . : . : . : . :
rJMSF016J15+ AAGATATGTCGGCTTATGGATTGTCGGAAGCTATCGGTGGAGGCCTGCATGCACGCTGTG
                      ____________________________________________________________
consensus AAGATATGTCGGCTTATGGATTGTCGGAAGCTATCGGTGGAGGCCTGCATGCACGCTGTG
 
. : . : . : . : . : . :
rJMSF016J15+ CAAAACGAGCGGCTTCCACTGCGAGTGGTTGTACAGGTTCTGTTCTTCGAGCAAGTAAGA
                      ____________________________________________________________
consensus CAAAACGAGCGGCTTCCACTGCGAGTGGTTGTACAGGTTCTGTTCTTCGAGCAAGTAAGA
 
. : . : . : . : . : . :
rJMSF016J15+ TCTGCAACGTCATCCGACGAGGGCAGCACTTCCACCCTCCCGGGATCAATCAGGGCGCTG
rJMFF028P05+ CGGGATCAATCAGGGCGCTG
                      ____________________________________________________________
consensus TCTGCAACGTCATCCGACGAGGGCAGCACTTCCACCCTCCCGGGATCAATCAGGGCGCTG
 
. : . : . : . : . : . :
rJMSF016J15+ CTACCGGGAGGATCCCACGGGAGCTCGCGGACCACTACAA-CCAACACCGAGGAGGATTG
rJMFF028P05+ CTACCGGGAGGATCCCACGGGAGCTCGCGGACCACTACAACCCAACACCGAGGAGGATTG
                      ____________________________________________________________
consensus CTACCGGGAGGATCCCACGGGAGCTCGCGGACCACTACAACCCAACACCGAGGAGGATTG
 
. : . : . : . : . : . :
rJMSF016J15+ GGACGCTGTGCCCACAGCCGAGGAGCTCAAGGCTTTGAAAGGCGAGCTCGCTACTCTGAA
rJMFF028P05+ GGACGCTGTGCCCACAGCCGAGGAGCTCAAGGCTTTGAAAGGCGAGCTCGCTACTCTGAA
                      ____________________________________________________________
consensus GGACGCTGTGCCCACAGCCGAGGAGCTCAAGGCTTTGAAAGGCGAGCTCGCTACTCTGAA
 
. : . : . : . : . : . :
rJMSF016J15+ GCTAAGGGATGGAGCAGGAAGCAACTACGACGGTCAGGCTAACGATGCGAAAACCAGCGC
rJMSF003C09+ TAAGGGATGGAGCAGGAAGCAACTACGACGGTCAGGCTAACGATGCGAAAACCAGCGC
rJMFF028P05+ GCTAAGGGATGGAGCAGGAAGCAACTACGACGGTCAGGCTAACGATGCGAAAACCAGCGC
                      ____________________________________________________________
consensus GCTAAGGGATGGAGCAGGAAGCAACTACGACGGTCAGGCTAACGATGCGAAAACCAGCGC
 
. : . : . : . : . : . :
rJMSF016J15+ CGAAAAGACGGCCACGAACAAAGTAAAGAACTTAATCGTGTGGAAGAAGATCTTCTCGAA
rJMSF003C09+ CGAAAAGACGGCCACGAACAAAGTAAAGAACTTAATCGTGTGGAAGAAGATCTTCTCGAA
rJMFF028P05+ CGAAAAGACGGCCACGAACAAAGTAAAGAACTTAATCGTGTGGAAGAAGATCTTCTCGAA
                      ____________________________________________________________
consensus CGAAAAGACGGCCACGAACAAAGTAAAGAACTTAATCGTGTGGAAGAAGATCTTCTCGAA
 
. : . : . : . : . : . :
rJMSF016J15+ GCTGTGGTCCAACAAAGATAGGCACAGTGAAAACAGCAGTTCAGATACCTCAGACAGCCC
rJMSF003C09+ GCTGTGGTCCAACAAAGATAGGCACAGTGAAAACAGCAGTTCAGATACCTCAGACAGCCC
rJMFF028P05+ GCTGTGGTCCAACAAAGATAGGCACAGTGAAAACAGCAGTTCAGATACCTCAGACAGCCC
                      ____________________________________________________________
consensus GCTGTGGTCCAACAAAGATAGGCACAGTGAAAACAGCAGTTCAGATACCTCAGACAGCCC
 
. : . : . : . : . : . :
rJMSF016J15+ TGCATCAACCACCGGGGACGAGACGAAGTCCACTCCGTCGAGAAGTAGGAGACACTCCTT
rJMSF003C09+ TGCATCAACCACCGGGGACGAGACGAAGTCCACTCCGTCGAGAAGTAGGAGACACTCCTT
rJMFF028P05+ TGCATCAACCACCGGGGACGAGACGAAGTCCACTCCGTCGAGAAGTAGGAGACACTCCTT
                      ____________________________________________________________
consensus TGCATCAACCACCGGGGACGAGACGAAGTCCACTCCGTCGAGAAGTAGGAGACACTCCTT
 
. : . : . : . : . : . :
rJMSF016J15+ GTCTTAGGCTGGGGATTCTATCGACATATGTAAAAGGTATTGTTCCAGTTACATTAGGAC
rJMSF003C09+ GTCTTAGGCTGGGGATTCTATCGACATATGTAAAAGGTATTGTTCCAGTTACATTAGGAC
rJMFF028P05+ GTCTTAGGCTGGGGATTCTATCGACATATGTAAAAGGTATTGTTCCAGTTACATTAGGAC
                      ____________________________________________________________
consensus GTCTTAGGCTGGGGATTCTATCGACATATGTAAAAGGTATTGTTCCAGTTACATTAGGAC
 
. : . : . : . : . : . :
rJMSF016J15+ TAGAATCAAATGATGTCTGCGAGCTAACAACTGTGAATGTAAGCAGTTAGTAGTTAAGTT
rJMSF003C09+ TAGAATCAAATGATGTCTGCGAGCTAACAACTGTGAATGTAAGCAGTTAGTAGTTAAGTT
rJMFF028P05+ TAGAATCAAATGATGTCTGCGAGCTAACAACTGTGAATGTAAGCAGTTAGTAGTTAAGTT
                      ____________________________________________________________
consensus TAGAATCAAATGATGTCTGCGAGCTAACAACTGTGAATGTAAGCAGTTAGTAGTTAAGTT
 
. : . : . : . : . : . :
rJMSF016J15+ TCCCTATGTAATTCTTTAGCAGCATTAGTTTGTGTTTGTTTTCACAATGTAGAGCACAGC
rJMSF003C09+ TCCCTATGTAATTCTTTAGCAGCATTAGTTTGTGTTTGTTTTCACAATGTAGAGCACAGC
rJMFF028P05+ TCCCTATGTAATTCTTTAGCAGCATTAGTTTGTGTTTGTTTTCACAATGTAGAGCACAGC
                      ____________________________________________________________
consensus TCCCTATGTAATTCTTTAGCAGCATTAGTTTGTGTTTGTTTTCACAATGTAGAGCACAGC
 
. : . : . : . : . : . :
rJMSF016J15+ TCAGAACAGACATTTTCTGTCTAAGGT
rJMSF003C09+ TCAGAACAGACATTTTCTGTCTAAGGT
rJMFF028P05+ TCAGAACAGACATTTTCTGTCTAAGGTTTTGCATTGTATTTTGTTGTCCCTGCAAGAAAA
                      ____________________________________________________________
consensus TCAGAACAGACATTTTCTGTCTAAGGTTTTGCATTGTATTTTGTTGTCCCTGCAAGAAAA