Previous Contig 009564:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF022I11Sequence480009564 (12)pir|T02387|T023878e-47hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153306009564 (12)pir|T02387|T023871e-22hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153
JMFF023D06Sequence650009564 (12)pir|T02387|T023875e-44hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153
JMFF025N19Sequence460009564 (12)pir|T02387|T023872e-47hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153692009564 (12)pir|T02387|T023874e-51hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153
JMFF028M24Sequence401009564 (12)pir|T02387|T023878e-35hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153736009564 (12)pir|T02387|T023874e-51hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153
JMFS012H08Sequence620009564 (12)pir|T02387|T023873e-51hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153
JMSF018P04Sequence450009564 (12)pir|T02387|T023877e-29hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153740009564 (12)pir|T02387|T023874e-51hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153
JMSF026M22Sequence582009564 (12)pir|T02387|T023874e-49hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153738009564 (12)pir|T02387|T023874e-51hypothetical protein At2g44310 [imported] - Arabidopsis thaliana>gb:AC004521_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF018P04- GAAGATTC
                      ____________________________________________________________
consensus GAAGATTC
 
. : . : . : . : . : . :
JMSF018P04- GTGCTCTAAATCTACAGAATATTTCTAAACATAGCAGAAAGCTTGCGAAAATATCGTAAA
                      ____________________________________________________________
consensus GTGCTCTAAATCTACAGAATATTTCTAAACATAGCAGAAAGCTTGCGAAAATATCGTAAA
 
. : . : . : . : . : . :
JMSF018P04- GCAGAAGCCATTTTCGCATAAATTCCATTCTTTTTTCATCTCTCAGATCTACAAATACTG
                      ____________________________________________________________
consensus GCAGAAGCCATTTTCGCATAAATTCCATTCTTTTTTCATCTCTCAGATCTACAAATACTG
 
. : . : . : . : . : . :
JMSF018P04- TTCTGGCGGCGAAGAAACAGTGTAAAAAAAATAAAAAATAAAAAATAAAAAAAAAATCAG
JMFF025N19- GTAAAAAAAATAAAAAATAAAAAATAAAAAAAAAATCAG
JMSF026M22- GTAAAAAAAATAAAAAATAAAAAATAAAAAAAAAATCAG
rJMSF026M22+ AAAAAATTAAAAATNAAAAAT-AAAAAAAAATCCG
rJMFF025N19+ AATAAAAAAAAAATCAG
rJMSF018P04+ TAAAAAAANTNAAAAATNAAAAATNAAAAAAAANTCAG
rJMFF028M24+ AAAAAAAAATCAG
                      ____________________________________________________________
consensus TTCTGGCGGCGAAGAAACAGTGTAAAAAAAATAAAAAATAAAAAATAAAAAAAAAATCAG
 
. : . : . : . : . : . :
JMSF018P04- GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
JMFF025N19- GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
JMSF026M22- GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
rJMSF026M22+ GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
JMFS012H08- GAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
JMFF022I11- TGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
JMFF028M24- TGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
rJMFF025N19+ GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
rJMSF018P04+ GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
rJMFF023D06+ TCGTGAAC
rJMFF028M24+ GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
                      ____________________________________________________________
consensus GCACAGAGAGAGATGGGAGTGGTGATTATCGACGGGTCAACGGTGCGAAACTTCGTGAAC
 
. : . : . : . : . : . :
JMSF018P04- GACGAANAGGCCTTCAACAAGGCCGTANACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
JMFF025N19- GACGAANAGGCCTTCAACAAGGCCGTANACGANAGGTTCTCGTCGCTGGATCTCAACGAC
JMSF026M22- GACGAANAGGCCTTCAACAAGGCCGTANACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
rJMSF026M22+ GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
JMFS012H08- GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
JMFF022I11- GACGAANAGGCCTTCAACAAGGCCGTANACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
JMFF028M24- GACGAANAGGCCTTCAACAAGGCCGTANACGANAGGTTCTCGTCGCTGGATCTCAACGAC
rJMFF025N19+ GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
rJMSF018P04+ GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
rJMFF023D06+ GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
rJMFF028M24+ GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
                      ____________________________________________________________
consensus GACGAAGAGGCCTTCAACAAGGCCGTAGACGAGAGGTTCTCGTCGCTGGATCTCAACGAC
 
. : . : . : . : . : . :
JMSF018P04- GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
JMFF025N19- GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
JMSF026M22- GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
rJMSF026M22+ GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
rJMFF022I11+ GCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCNGTNTCATCGAG
JMFS012H08- GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
JMFF022I11- GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
JMFF028M24- GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
rJMFF025N19+ GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
rJMSF018P04+ GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
rJMFF023D06+ GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
rJMFF028M24+ GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
                      ____________________________________________________________
consensus GACGGCGTCCTGTCGCGCTCGGAGCTGCGGAATGCGTTCGAGTCGTTCCGTCTCATCGAG
 
. : . : . : . : . : . :
JMSF018P04- ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
JMFF025N19- ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
JMSF026M22- ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
rJMSF026M22+ ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
rJMFF022I11+ ANTCNCTTCGGCGTCGACGCCNCCNNTCNGCCGGANGAGCTGCCCAAGNTCTNCGNCTCC
JMFS012H08- ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
JMFF022I11- ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
JMFF028M24- ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
rJMFF025N19+ ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
rJMSF018P04+ ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
rJMFF023D06+ ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
rJMFF028M24+ ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
                      ____________________________________________________________
consensus ACTCACTTCGGCGTCGACGCCGCCACTCCGCCGGATGAGCTGCCCAAGCTCTACGACTCC
 
. : . : . : . : . : . :
JMSF018P04- ATATTCGAGAAGTTCGATTTAG
JMFF025N19- ATATTCGAGAAGTTCGATTTANATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
JMSF026M22- ATATTCGAGAAGTTCGATTTAGATCANAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
rJMSF026M22+ ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
rJMFF022I11+ ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGN
JMFS012H08- ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
JMFF022I11- ATATTCGAGAAGTTCGATTTANATCANAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
JMFF028M24- ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
rJMFF025N19+ ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
rJMSF018P04+ ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
rJMFF023D06+ ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
rJMFF028M24+ ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
                      ____________________________________________________________
consensus ATATTCGAGAAGTTCGATTTAGATCAGAGCGGCACCATCGACCGTGACGAGTTCAAGAGC
 
. : . : . : . : . : . :
JMFF025N19- GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCANATG
JMSF026M22- GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
rJMSF026M22+ GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
rJMFF022I11+ GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATNGTCGCCGATCCAGATG
JMFS012H08- GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
JMFF022I11- GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
JMFF028M24- GAGATG
rJMFF025N19+ GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
rJMSF018P04+ GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
rJMFF023D06+ GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
rJMFF028M24+ GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
                      ____________________________________________________________
consensus GAGATGAAGAAGATCATGCTCGCCATAGCCGATGGATTCGGATCGTCGCCGATCCAGATG
 
. : . : . : . : . : . :
JMFF025N19- GNGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAG
JMSF026M22- GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
rJMSF026M22+ GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
rJMFF022I11+ GTGCTTGACGATAGCTNTGGCGATAATAACNTCCTCAAACAAGCCGCNGNCCGGGAAGCC
JMFS012H08- GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
JMFF022I11- GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGA
rJMFF025N19+ GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
rJMSF018P04+ GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
rJMFF023D06+ GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
rJMFF028M24+ GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
                      ____________________________________________________________
consensus GTGCTTGACGATAGCTTTGGCGATAATAACTTCCTCAAACAAGCCGCCGACCGGGAAGCC
 
. : . : . : . : . : . :
JMSF026M22- GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
rJMSF026M22+ GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
rJMFF022I11+ GCCCAGTTCTCCGC
JMFS012H08- GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
rJMFF025N19+ GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
rJMSF018P04+ GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
rJMFF023D06+ GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
rJMFF028M24+ GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
                      ____________________________________________________________
consensus GCCCAGTTCTCCGCCTGAACATGGAATCGAATCTGAAACGGTAAAATAACTCCGATCCGG
 
. : . : . : . : . : . :
JMSF026M22- CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
rJMSF026M22+ CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
JMFS012H08- CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
rJMFF025N19+ CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
rJMSF018P04+ CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
rJMFF023D06+ CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
rJMFF028M24+ CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
                      ____________________________________________________________
consensus CAGTTTATTCGGCCAATTTTCTTCTTGAAATATCGTGTTTAATAAGTTTTGGTTATCCAT
 
. : . : . : . : . : . :
JMSF026M22- TA
rJMSF026M22+ TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
JMFS012H08- TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
rJMFF025N19+ TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
rJMSF018P04+ TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
rJMFF023D06+ TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
rJMFF028M24+ TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
                      ____________________________________________________________
consensus TACTGTCACTAAGAATTATGGTGCAAGTTTGATTACAGAAACTTGTCATTCGTGGTATGT
 
. : . : . : . : . : . :
rJMSF026M22+ TTTAGGATCAATATTGTTGGTATGAAATTATTTCAACCAACCATAGTAGTTCAATTATTG
JMFS012H08- TTTAGGATCAATATTGTTGGTATGAAATT
rJMFF025N19+ TTTAGGATCAATATTGTTGGTATGAAATTATTTCAACCAACCATAGTAGTTCAATTATTG
rJMSF018P04+ TTTAGGATCAATATTGTTGGTATGAAATTATTTCAACCAACCATAGTAGTTCAATTATTG
rJMFF023D06+ TTTAGGATCAATATTGTTGGTATGAAATTATTTCAACCAACCATAGTAGTTCAATTATTG
rJMFF028M24+ TTTAGGATCAATATTGTTGGTATGAAATTATTTCAACCAACCATAGTAGTTCAATTATTG
                      ____________________________________________________________
consensus TTTAGGATCAATATTGTTGGTATGAAATTATTTCAACCAACCATAGTAGTTCAATTATTG
 
. : . : . : . : . : . :
rJMSF026M22+ TCAATAAGAAAAGACGAGTAGGATATGAACGATGAAATTAT
rJMFF025N19+ TCAATAAGAAAAGAC
rJMSF018P04+ TCAATAAGAAAAGACGAGTAGGATATGAACGATGAAATTAT
rJMFF023D06+ TCAATAAGAAAAGACGAGTAGGATATGAACGATGAAATTAT
rJMFF028M24+ TCAATAAGAAAAGACGAGTAGGATATGAACGATGAAATTATGTGTTTGATGATAGGAAAA
                      ____________________________________________________________
consensus TCAATAAGAAAAGACGAGTAGGATATGAACGATGAAATTATGTGTTTGATGATAGGAAAA