Previous Contig 009558:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028K15Sequence540009558 (8)gb:AY084453_15695436e-11Arabidopsis thaliana clone 108568 mRNA, complete sequence.619009558 (8)gb:CAR299062_16452355e-50Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.
JMFF044B11Sequence620004367 (7)gb:AF030879_17625131e-24Solanum tuberosum protein kinase CPK1 mRNA, complete cds.623009558 (8)gb:CAR299062_16452355e-50Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.
JMSF017N10Sequence522005717 (14)sp|O04066|ACBP_RICCO4e-31Acyl-CoA-binding protein (ACBP).>pir|T09844|T09844 acyl-CoA-binding protein - ca799009558 (8)gb:CAR299062_16452353e-59Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.
JMSF020N03Sequence660009558 (8)gb:AY084453_15695431e-17Arabidopsis thaliana clone 108568 mRNA, complete sequence.755009558 (8)gb:CAR299062_16452352e-60Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.
JMSF025L23Sequence642009558 (8)gb:AY084453_15695432e-14Arabidopsis thaliana clone 108568 mRNA, complete sequence.822009558 (8)gb:CAR299062_16452354e-59Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF028K15- CTGAAAACAAAAT
                      ____________________________________________________________
consensus CTGAAAACAAAAT
 
. : . : . : . : . : . :
JMFF028K15- CTCAAGTACTGCAATACCCTAACACCGCACCGCAGTACTCCACCCACAATCGACTTATAT
JMSF025L23- AGTACTGCAATACCCTAACACCGCACCGCAGTACTCCACCCACAATCGACTTATAT
JMSF020N03- AGTACTGCAATACCCTAACACCGCACCGCAGTACTCCACCCACAATCGACTTATAT
                      ____________________________________________________________
consensus CTCAAGTACTGCAATACCCTAACACCGCACCGCAGTACTCCACCCACAATCGACTTATAT
 
. : . : . : . : . : . :
JMFF028K15- TGGAATCACTTTCTTCAGACTTCTCATCTGGTTCTATCTTTAATTGTCAAGAAATGGAGA
JMSF025L23- TGGAATCACTTTCTTCAGACTTCTCATCTGGTTCTATCTTTAATTGTCAAGAAATGGAGA
JMSF020N03- TGGAATCACTTTCTTCAGACTTCTCATCTGGTTCTATCTTTAATTGTCAAGAAATGGAGA
                      ____________________________________________________________
consensus TGGAATCACTTTCTTCAGACTTCTCATCTGGTTCTATCTTTAATTGTCAAGAAATGGAGA
 
. : . : . : . : . : . :
JMFF028K15- ACGCCAAAGCTAATAATGGAACCAACAACGGCGGCGAAGTGGCTAAAACCACCGCCGACG
JMSF025L23- ACGCCAAAGCTAATAATGGAACCAACAACGGCGGCGAAGTGGCTAAAACCACCGCCGACG
JMSF020N03- ACGCCAAAGCTAATAATGGAACCAACAACGGCGGCGAAGTGGCTAAAACCACCGCCGACG
                      ____________________________________________________________
consensus ACGCCAAAGCTAATAATGGAACCAACAACGGCGGCGAAGTGGCTAAAACCACCGCCGACG
 
. : . : . : . : . : . :
JMFF028K15- ACCACCAGGAAAACCCTATTAATAATTTGCCAACTAATAACACTAGTGCTATACCTGCGC
JMSF025L23- ACCACCAGGAAAACCCTATTAATAATTTGCCAACTAATAACACTAGTGCTATACCTGCGC
JMSF020N03- ACCACCAGGAAAACCCTATTAATAATTTGCCAACTAATAACACTAGTGCTATACCTGCGC
                      ____________________________________________________________
consensus ACCACCAGGAAAACCCTATTAATAATTTGCCAACTAATAACACTAGTGCTATACCTGCGC
 
. : . : . : . : . : . :
JMFF028K15- CAGTAGCGGAGGAGAGCCGCGAGGGTGAATTTGGTGCTAGTACAAATGTAAATCAAGGCG
JMSF025L23- CAGTAGCGGAGGAGAGCCGCGAGGGTGAATTTGGTGCTAGTACAAATGTAAATCAAGGCG
JMSF020N03- CAGTAGCGGAGGAGAGCCGCGAGGGTGAATTTGGTGCTAGTACAAATGTAAATCAAGGCG
                      ____________________________________________________________
consensus CAGTAGCGGAGGAGAGCCGCGAGGGTGAATTTGGTGCTAGTACAAATGTAAATCAAGGCG
 
. : . : . : . : . : . :
JMFF028K15- CCCAAGGAGGGCGCCAGCCTTCTAGGAGAACTCCCTTCACCGACCTCAGCCAAATCGATG
JMSF025L23- CCCAAGGAGGGCGCCAGCCTTCTAGGAGAACTCCCTTCACCGACCTCAGCCAAATCGATG
JMSF020N03- CCCAAGGAGGGCGCCAGCCTTCTAGGAGAACTCCCTTCACCGACCTCAGCCAAATCGATG
                      ____________________________________________________________
consensus CCCAAGGAGGGCGCCAGCCTTCTAGGAGAACTCCCTTCACCGACCTCAGCCAAATCGATG
 
. : . : . : . : . : . :
JMFF028K15- CTGATCTCGCCCTTGCCCGCACCTTACAGGAGCAGGAAAGAGCATATATGATGCTTACAA
JMSF025L23- CTGATCTCGCCCTTGCCCGCACCTTACAGGAGCAGGAAAGAGCATATATGATGCTTACAA
JMSF020N03- CTGACCTCGCCCTTGCCCGCACCTTACAGGAGCAGGAAAGAGCATATATGATGCTTACAA
rJMSF025L23+ CAGGAAAGAGCATATNTGATGCTTACAA
                      ____________________________________________________________
consensus CTGATCTCGCCCTTGCCCGCACCTTACAGGAGCAGGAAAGAGCATATATGATGCTTACAA
 
. : . : . : . : . : . :
JMFF028K15- TGAATGGTGATGCGAGTGATTATGTCAGTGAAGATGAATATGGATATGATTATGATGATG
JMSF025L23- TGAATGGTGATGCGAGTGATTATGTCAGTGAAGATGAATATGGATATGATTATGATGATG
JMSF020N03- TGAATGGTGATGCGAGTGATTATGTCAGTGAAGATGAATATGGATATGATTATGATGATG
rJMSF025L23+ TGAATGGTGATGCGAGTGATTATGTCAGTGAAGATGAATATGGATATGATTATGATGATG
rJMSF020N03+ AGTGAAGATGAATATGGATATGATTATGATGATG
rJMSF017N10+ GCGAGTGATTATGTCAGTGAAGATGAATATGGATATGATTATGATGATG
                      ____________________________________________________________
consensus TGAATGGTGATGCGAGTGATTATGTCAGTGAAGATGAATATGGATATGATTATGATGATG
 
. : . : . : . : . : . :
JMFF028K15- ATGATAA-TTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGAT
JMSF025L23- ATGATAA-TTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGATGAGGAGGATGAA
JMSF020N03- ATGATAA-TTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGATGAGGAGGATGAA
rJMSF025L23+ ATGATAA-TTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGATGAGGAGGATGAA
rJMSF020N03+ ATGATAATTTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGATGAGGAGGATGAA
rJMSF017N10+ ATGATAA-TTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGATGAGGAGGATGAA
                      ____________________________________________________________
consensus ATGATAA-TTTCGATGATCCTAGTGAAGAAGATGGCAGCCATGTAGATGAGGAGGATGAA
 
. : . : . : . : . : . :
JMSF025L23- GATGCCTTTGATGTTCATGCTCATGATGAAGCAAGTGAGGATGAGAACTTAGGTATTGAG
JMSF020N03- GATGCCTTTGATGTTCATGCTCATGATGAAGCAAGTGAGGATGAGAACTTAGGTATTGAG
rJMSF025L23+ GATGCCTTTGATGTTCATGCTCATGATGAAGCAAGTGAGGATGAGAACTTAGGTATTGAG
rJMSF020N03+ GATGCCTTTGATGTTCATGCTCATGATGAAGCAAGTGAGGATGAGAACTTAGGTATTGAG
rJMSF017N10+ GATGCCTTTGATGTTCATGCTCATGATGAAGCAAGTGAGGATGAGAACTTAGGTATTGAG
                      ____________________________________________________________
consensus GATGCCTTTGATGTTCATGCTCATGATGAAGCAAGTGAGGATGAGAACTTAGGTATTGAG
 
. : . : . : . : . : . :
JMSF025L23- CTGGACCCATCTGCTTTTCCAAGTGATGAGGCTTATGCTAGAGCA
JMSF020N03- CTGGACCCATCTGCTTTTCCAAGTGATGAGGCTTATGCTAGAGCACTACAAGAAGCTGAA
rJMSF025L23+ CTGGACCCATCTGCTTTTCCAAGTGATGAGGCTTATGCTAGAGCACTACAAGAAGCTGAA
rJMSF020N03+ CTGGACCCATCTGCTTTTCCAAGTGATGAGGCTTATGCTAGAGCACTACAAGAAGCTGAA
rJMSF017N10+ CTGGACCCATCTGCTTTTCCAAGTGATGAGGCTTATGCTAGAGCACTACAAGAAGCTGAA
rJMFF044B11+ TGAA
                      ____________________________________________________________
consensus CTGGACCCATCTGCTTTTCCAAGTGATGAGGCTTATGCTAGAGCACTACAAGAAGCTGAA
 
. : . : . : . : . : . :
JMSF020N03- GAG
rJMSF025L23+ GAGAGGGAAATGGCAGCCAGATTGCTGGCCCTTGCTGGGATAAATGAAGGCCAAGCTCTA
rJMSF020N03+ GAGAGGGAAATGGCAGCCAGATTGCTGGCCCTTGCTGGGATAAATGAAGGCCAAGCTCTA
rJMSF017N10+ GAGAGGGAAATGGCAGCCAGATTGCTGGCCCTTGCTGGGATAAATGAAGGCCAAGCTCTA
rJMFF044B11+ GAGAGGGAAATGGCAGCCAGATTGCTGGCCCTTGCTGGGATAAATGAAGGCCAAGCTCTA
rJMFF028K15+ GATAAATGAAGGCCAAGCTCTA
                      ____________________________________________________________
consensus GAGAGGGAAATGGCAGCCAGATTGCTGGCCCTTGCTGGGATAAATGAAGGCCAAGCTCTA
 
. : . : . : . : . : . :
rJMSF025L23+ AGTGAAGAAGATCATGGCCAAAATTCCCAGGATGCCTGGGAGGAAGTTGATCCAGATGAA
rJMSF020N03+ AGTGAAGAAGATCATGGCCAAAATTCCCAGGATGCCTGGGAGGAAGTTGATCCAGATGAA
rJMSF017N10+ AGTGAAGAAGATCATGGCCAAAATTCCCAGGATGCCTGGGAGGAAGTTGATCCAGATGAA
rJMFF044B11+ AGTGAAGAAGATCATGGCCAAAATTCCCAGGATGCCTGGGAGGAAGTTGATCCAGATGAA
rJMFF028K15+ AGT-AAGAAGATCATGGCCAAAATTCCCAGGATGCCTGGGAGGAAGTTGATCCAGATGAA
                      ____________________________________________________________
consensus AGTGAAGAAGATCATGGCCAAAATTCCCAGGATGCCTGGGAGGAAGTTGATCCAGATGAA
 
. : . : . : . : . : . :
rJMSF025L23+ CTCTCTTATGAGGAATTATTAGCGTTGGGTGAAGTAGTTGGAACTGAGAGCAGGGGACTT
rJMSF020N03+ CTCTCTTATGAGGAATTATTAGCGTTGGGTGAAGTAGTTGGAACTGAGAGCAGGGGACTT
rJMSF017N10+ CTCTCTTATGAGGAATTATTAGCGTTGGGTGAAGTAGTTGGAACTGAGAGCAGGGGACTT
rJMFF044B11+ CTCTCTTATGAGGAATTATTAGCGTTGGGTGAAGTAGTTGGAACTGAGAGCAGGGGACTT
rJMFF028K15+ CTCTCTTATGAGGAATTATTAGCGTTGGGTGAAGTAGTTGGAACTGAGAGCAGGGGACTT
                      ____________________________________________________________
consensus CTCTCTTATGAGGAATTATTAGCGTTGGGTGAAGTAGTTGGAACTGAGAGCAGGGGACTT
 
. : . : . : . : . : . :
rJMSF025L23+ TCTGCAGATACAATTGCCTCTTTACCTTCAATGAACTACAAATCACAAAATACTCAGGAT
rJMSF020N03+ TCTGCAGATACAATTGCCTCTTTACCTTCAATGAACTACAAATCACAAAATACTCAGGAT
rJMSF017N10+ TCTGCAGATACAATTGCCTCTTTACCTTCAATGAACTACAAATCACAAAATACTCAGGAT
rJMFF044B11+ TCTGCAGATACAATTGCCTCTTTACCTTCAATGAACTACAAATCACAAAATACTCAGGAT
rJMFF028K15+ TCTGCAGATACAATTGCCTCTTTACCTTCAATGAACTACAAATCACAAAATACTCAGGAT
                      ____________________________________________________________
consensus TCTGCAGATACAATTGCCTCTTTACCTTCAATGAACTACAAATCACAAAATACTCAGGAT
 
. : . : . : . : . : . :
rJMSF025L23+ GGAGCAAATGATTCATGTGTCATCTGTAGATTGGATTATGAAGATGGCGAGACCTTGACC
rJMSF020N03+ GGAGCAAATGATTCATGTGTCATCTGTAGATTGGATTATGAAGATGGCGAGACCTTGACC
rJMSF017N10+ GGAGCAAATGATTCATGTGTCATCTGTAGATTGGATTATGAAGATGGCGAGACCTTGACC
rJMFF044B11+ GGAGCAAATGATTCATGTGTCATCTGTAGATTGGATTATGAAGATGGCGAGACCTTGACC
rJMFF028K15+ GGAGCAAATGATTCATGTGTCATCTGTAGATTGGATTATGAAGATGGCGAGACCTTGACC
                      ____________________________________________________________
consensus GGAGCAAATGATTCATGTGTCATCTGTAGATTGGATTATGAAGATGGCGAGACCTTGACC
 
. : . : . : . : . : . :
rJMSF025L23+ GTGCTTTCCTGCAAACATTCTTACCATTCTGAATGTATAAATAACTGGCTAAGAATAAAC
rJMSF020N03+ GTGCTTTCCTGCAAACATTCTTACCATTCTGAATGTATAAATAACTGGCTAAGAATAAAC
rJMSF017N10+ GTGCTTTCCTGCAAACATTCTTACCATTCTGAATGTATAAATAACTGGCTAAGAATAAAC
rJMFF044B11+ GTGCTTTCCTGCAAACATTCTTACCATTCTGAATGTATAAATAACTGGCTAAGAATAAAC
rJMFF028K15+ GTGCTTTCCTGCAAACATTCTTACCATTCTGAATGTATAAATAACTGGCTAAGAATAAAC
                      ____________________________________________________________
consensus GTGCTTTCCTGCAAACATTCTTACCATTCTGAATGTATAAATAACTGGCTAAGAATAAAC
 
. : . : . : . : . : . :
rJMSF025L23+ AAGGTGTGTCCTGTCTGTAGTGCTGAAGTCTCCACTTCTGGTAACAGTTAGCAGATATAG
rJMSF020N03+ AAGGTGTGTCCTGTCTGTAGTGCTGAAGTCTCCACTTCTGGTAACAGTTAGCAGATATAG
rJMSF017N10+ AAGGTGTGTCCTGTCTGTAGTGCTGAAGTCTCCACTTCTGGTAACAGTTAGCAGATATAG
rJMFF044B11+ AAGGTGTGTCCTGTCTGTAGTGCTGAAGTCTCCACTTCTGGTAACAGTTAGCAGATATAG
rJMFF028K15+ AAGGTGTGTCCTGTCTGTAGTGCTGAAGTCTCCACTTCTGGTAACAGTTAGCAGATATAG
                      ____________________________________________________________
consensus AAGGTGTGTCCTGTCTGTAGTGCTGAAGTCTCCACTTCTGGTAACAGTTAGCAGATATAG
 
. : . : . : . : . : . :
rJMSF025L23+ ATAGTGAATGCCCCTGAGGCTGAGGGAGGAGGATGCAGGATTTCTTAGGAATCAAGCATG
rJMSF020N03+ ATAGTGAATGCCCCTGAGGCTGAGGGAGGAGGATGCAGGATTTCTTAGGAATCAAGCATG
rJMSF017N10+ ATAGTGAATGCCCCTGAGGCTGAGGGAGGAGGATGCAGGATTTCTTAGGAATCAAGCATG
rJMFF044B11+ ATAGTGAATGCCCCTGAGGCTGAGGGAGGAGGATGCAGGATTTCTTAGGAATCAAGCATG
rJMFF028K15+ ATAGTGAATGCCTCTGAGGCTGAGGGAGGAGGATGCAGGATTTCTTAGGAATCAAGCATG
                      ____________________________________________________________
consensus ATAGTGAATGCCCCTGAGGCTGAGGGAGGAGGATGCAGGATTTCTTAGGAATCAAGCATG
 
. : . : . : . : . : . :
rJMSF025L23+ AAACACCAATCCTGTATGCCAATGTCTTTGGTTCCTACCCAAAAANCAGTGTCTGCTCAA
rJMSF020N03+ AAACACCAATCCTGTATGCCAATGTCTTTGGTTCCTACCCAAAAACCAGTGTCTGCTCAA
rJMSF017N10+ AAACACCAATCCTGTATGCCAATGTCTTTGGTTCCTACCCAAAAAGCAGTGTCTGCTCAA
rJMFF044B11+ AAACACCAATCCTGTATGCCAATGTCTTTGGTTCCTACCCAAAAA-CAGTGTCTGCTCAA
rJMFF028K15+ AAACACCAATCCTGTATGCCAATGTCTTTGGTTCCTACCCAAAAA-CAGTGTCTGCTCAA
                      ____________________________________________________________
consensus AAACACCAATCCTGTATGCCAATGTCTTTGGTTCCTACCCAAAAAGCAGTGTCTGCTCAA
 
. : . : . : . : . : . :
rJMSF025L23+ C
rJMSF020N03+ C
rJMSF017N10+ CCATTGTGCCATTATTTTATATACTATCACA
rJMFF044B11+ -CATTGTGCCATTATTTTATATACTATCACATATAACTTGAGAATTTTAGTGGTTTTATA
rJMFF028K15+ -CATTGTGCCATTATTTTATATACTATCACATATAACTTGAGAATTTTAGTGGTTTTATA
                      ____________________________________________________________
consensus CCATTGTGCCATTATTTTATATACTATCACATATAACTTGAGAATTTTAGTGGTTTTATA
 
. : . : . : . : . : . :
rJMFF044B11+ TTGGTCGCTATACTTTGTCAT
rJMFF028K15+ TTGGTCGCTATACTTTGTCATAATTCCTTTTCGGGTGGAAGTCTGCCTTTACATTCACAA
                      ____________________________________________________________
consensus TTGGTCGCTATACTTTGTCATAATTCCTTTTCGGGTGGAAGTCTGCCTTTACATTCACAA