Previous Contig 009556:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011M15Sequence277000619 (5)gb:HHV6AGNM_24101275e-15Human herpesvirus-6 (HHV-6) U1102, variant A DNA, complete virion genome.679009556 (3)gb:AK175625_18176139e-68Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-10-L11.>gb:AK175859_18178
JMFF025E02Sequence544000619 (5)gb:AK175625_18176132e-18Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-10-L11.>gb:AK175859_18178688009556 (3)gb:AK175625_18176133e-72Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-10-L11.>gb:AK175859_18178
JMFF028J23Sequence507000619 (5)gb:AK175625_18176134e-15Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-10-L11.>gb:AK175859_18178679009556 (3)gb:AK175625_18176131e-66Arabidopsis thaliana mRNA, complete cds, clone: RAFL22-10-L11.>gb:AK175859_18178

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025E02+ GCATACAGAGAATGAGTCGAATGCGACTGCCTTGATATCTNTG
                      ____________________________________________________________
consensus GCATACAGAGAATGAGTCGAATGCGACTGCCTTGATATCTNTG
 
. : . : . : . : . : . :
rJMFF025E02+ GGCCGAATGTTGTCCGAAAGCATCCACACCGACATCCAAATCAACACTGCAGACGGGAGC
rJMFF011M15+ TCAACACTGCAGACGGGAGC
rJMFF028J23+ TCAACACTGCAGACGGGAGC
                      ____________________________________________________________
consensus GGCCGAATGTTGTCCGAAAGCATCCACACCGACATCCAAATCAACACTGCAGACGGGAGC
 
. : . : . : . : . : . :
rJMFF025E02+ ATTGCCGCCCACCGAGCCGTCCTCGCTGCGAGGTCGCCCGTCTTCCGAAGCATGTTCTCT
rJMFF011M15+ ATTGCCGCCCACCGAGCCGTCCTCGCTGCGAGGTCGCCCGTCTTCCGAAGCATGTTCTCT
rJMFF028J23+ ATTGCCGCCCACCGAGCCGTCCTCGCTGCGAGGTCGCCCGTCTTCCGAAGCATGTTCTCT
                      ____________________________________________________________
consensus ATTGCCGCCCACCGAGCCGTCCTCGCTGCGAGGTCGCCCGTCTTCCGAAGCATGTTCTCT
 
. : . : . : . : . : . :
rJMFF025E02+ CACGACCTCAAGGAGAAAGAGATGTCCACCGTGGACATCTCCGATTATGTCGGGCGAGGC
rJMFF011M15+ CACGACCTCAAGGAGAAAGAGATGTCCACCGTGGACATCTCCGA-TATGTCGGGCGAGGC
rJMFF028J23+ CACGACCTCAAGGAGAAAGAGATGTCCACCGTGGACATCTCCGA-TAAGTCGGGCGAGGC
                      ____________________________________________________________
consensus CACGACCTCAAGGAGAAAGAGATGTCCACCGTGGACATCTCCGA-TATGTCGGGCGAGGC
 
. : . : . : . : . : . :
rJMFF025E02+ TTGCCAGGCTTTCCTCAATTACATATACGGGAACATCCAGAACGGGGAATTCTTGACCCA
rJMFF011M15+ TTGCCAGGCTTTCCTCAATTACATATACGGGAACATCCAGAACGGGGAATTCTTGACCCA
rJMFF028J23+ TTGCCAGGCTTTCCTCAATTACATATACGGGAACATCCAGAACGGGGAATTCTTGACCCA
                      ____________________________________________________________
consensus TTGCCAGGCTTTCCTCAATTACATATACGGGAACATCCAGAACGGGGAATTCTTGACCCA
 
. : . : . : . : . : . :
rJMFF025E02+ CCGGTTACCCCTGCTCCGGGCAGCCGACAAGTACGACGTCACGGACCTGAAAGAGGCGTG
rJMFF011M15+ CCGGTTACCCCTGCTCCGGGCAGCCGACAAGTACGACGTCACGGACCTGAAAGAGGCGTG
rJMFF028J23+ CCGGTTACCCCTGCTCCGGGCAGCCGACAAGTACGACGTCACGGACCTGAAAGAGGCGTG
                      ____________________________________________________________
consensus CCGGTTACCCCTGCTCCGGGCAGCCGACAAGTACGACGTCACGGACCTGAAAGAGGCGTG
 
. : . : . : . : . : . :
rJMFF025E02+ CCACGAGAGCCTGCTGCAGGACATTGACACCAAGAACGTTCTCGAGAGGCTCCAAAACGC
rJMFF011M15+ CCACGAGAGCCTGCTGCAGGACATTGACACCAAGAACGTTCTCGAGAGGCTCCAAAACGC
rJMFF028J23+ CCACGAGAGCCTGCTGCAGGACATTGACACCAAGAACGTTCTCGAGAGGCTCCAAAACGC
                      ____________________________________________________________
consensus CCACGAGAGCCTGCTGCAGGACATTGACACCAAGAACGTTCTCGAGAGGCTCCAAAACGC
 
. : . : . : . : . : . :
rJMFF025E02+ CTCGCTTTATCAGCTCCCGAAGCTCAAGGCTTGTTGCATGCAGTATCTCGTGAAGTTCGG
rJMFF011M15+ CTCGCTTTATCAGCTCCCGAAGCTCAAGGCTTGTTGCATGCAGTATCTCGTGAAGTTCGG
rJMFF028J23+ CTCGCTTTATCAGCTCCCGAAGCTCAAGGCTTGTTGCATGCAGTATCTCGTGAAGTTCGG
                      ____________________________________________________________
consensus CTCGCTTTATCAGCTCCCGAAGCTCAAGGCTTGTTGCATGCAGTATCTCGTGAAGTTCGG
 
. : . : . : . : . : . :
rJMFF025E02+ TAAGATTTATGACATTCACGACGATTTTAATGTGTTTCTGCAATATGCAGATAGAGAGCT
rJMFF011M15+ TAAGATTTATGACATTCACGACGATTTTAATGTGTTTCTGCAATATGCAGATAGAGAGCT
rJMFF028J23+ TAAGATTTATGACATTCACGACGATTTTAATGTGTTTCTGCAATATGCAGATAGAGAGCT
                      ____________________________________________________________
consensus TAAGATTTATGACATTCACGACGATTTTAATGTGTTTCTGCAATATGCAGATAGAGAGCT
 
. : . : . : . : . : . :
rJMFF025E02+ GATTTCTGAAGTCTTTCATGAAATTCTTGGTGTCTGGAAAGGGTTCTGAATTTCTGGGTT
rJMFF011M15+ GATTTCTGAAGTCTTTCATGAAATTCTTGGTGTCTGGAAAGGGTTCTGAATTTCTGGGTT
rJMFF028J23+ GATTTCTGAAGTCTTTCATGAAATTCTTGGTGTCTGGAAAGGGTTCTGAATTTCTGGGTT
                      ____________________________________________________________
consensus GATTTCTGAAGTCTTTCATGAAATTCTTGGTGTCTGGAAAGGGTTCTGAATTTCTGGGTT
 
. : . : . : . : . : . :
rJMFF025E02+ GAAGAAAGTGAGGAAGGAATTCATTGGGAATGTTTGTATCAAATTGTTATTGGTGTTTCA
rJMFF011M15+ GAAGAAAGTGAGGAAGGAATTCATTGGGAATGTTTGTATCAAATTGTTATTGGTGTTTCA
rJMFF028J23+ GAAGAAAGTGAGGAAGGAATTCATTGGGAATGTTTGTATCAAATTGTTATTGGTGTTTCA
                      ____________________________________________________________
consensus GAAGAAAGTGAGGAAGGAATTCATTGGGAATGTTTGTATCAAATTGTTATTGGTGTTTCA
 
. : . : . : . : . : . :
rJMFF025E02+ GTTGTGTGCAACCATTTGTTCATTGGATAAAATTTGTT
rJMFF011M15+ GTTGTGTGCAACCATTTGTTCATTGGATAAAATTTGTTTGTTCAATGGAATTNGTCTGTG
rJMFF028J23+ GTTGTGTGCAACCATTTGTTCATTGGATAAAATTTGTTTGTTCAATGGAATTTGTCTGTG
                      ____________________________________________________________
consensus GTTGTGTGCAACCATTTGTTCATTGGATAAAATTTGTTTGTTCAATGGAATTTGTCTGTG
 
. : . : . : . : . : . :
rJMFF011M15+ TATATAATTTATATATACCTAGACATGTACAGATCAATTTCACCAACTGAACAGATCA
rJMFF028J23+ TATATAATTTATATATACCTAGACATGTACAGATCAATTTCACCAACTGAACAGATCATG
                      ____________________________________________________________
consensus TATATAATTTATATATACCTAGACATGTACAGATCAATTTCACCAACTGAACAGATCATG