Previous Contig 009554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028J05Sequence474007492 (17)722009554 (5)gb:AF499737_18061723e-44Oryza sativa (japonica cultivar-group) beta-galactosidase mRNA, complete cds.>gb
JMFF036O01Sequence563007492 (17)gb:AF154424_17729313e-33Lycopersicon esculentum putative beta-galactosidase (TBG6) mRNA, complete cds.718009554 (5)gb:AF499737_18061722e-48Oryza sativa (japonica cultivar-group) beta-galactosidase mRNA, complete cds.>gb
JMFS154G01Sequence601009554 (5)gb:AF154424_17729317e-31Lycopersicon esculentum putative beta-galactosidase (TBG6) mRNA, complete cds.
JMSF036J11Sequence650007492 (17)gb:AF154424_17729315e-48Lycopersicon esculentum putative beta-galactosidase (TBG6) mRNA, complete cds.785009554 (5)gb:AF154424_17729317e-51Lycopersicon esculentum putative beta-galactosidase (TBG6) mRNA, complete cds.
JMSF042I07Sequence750007492 (17)gb:AF154424_17729317e-48Lycopersicon esculentum putative beta-galactosidase (TBG6) mRNA, complete cds.761009554 (5)gb:AF154424_17729311e-51Lycopersicon esculentum putative beta-galactosidase (TBG6) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036J11+ TGACN
                      ____________________________________________________________
consensus TGACN
 
. : . : . : . : . : . :
rJMSF042I07+ TTGGTCGCACGACAACAACCTCTGACATGGTACAAGGCTTATTTCAAT
rJMFF036O01+ ATGGTACAAGGCTTATTTCAAT
rJMSF036J11+ GATTGAAGGTCCTTGGTCGCACGACAACAACNTCTGACATGGTACAAGGCTTATTTCAAT
rJMFF028J05+ AT
                      ____________________________________________________________
consensus GATTGAAGGTCCTTGGTCGCACGACAACAACCTCTGACATGGTACAAGGCTTATTTCAAT
 
. : . : . : . : . : . :
rJMSF042I07+ GAGCCAAGTGGAAACGAGCCCTTGGCATTGGACATGGGTAGTATGGGAAAAGGCCAAGCG
rJMFF036O01+ GAGCCAAGTGGAAACGAGCCCTTGGCATTGGACATGGGTAGTATGGGAAAAGGCCAGGCG
rJMSF036J11+ GAGCCAAGTGGAAACGAGCCCTTGGCATTGGACATGGGTAGTATGGGAAAAGGCCAAGCG
rJMFF028J05+ GAGCCAAGTGGAAACGAGCCCTTGGCATTGGACATGGGTAGTATGGGAAAAGGCCAAGCG
                      ____________________________________________________________
consensus GAGCCAAGTGGAAACGAGCCCTTGGCATTGGACATGGGTAGTATGGGAAAAGGCCAAGCG
 
. : . : . : . : . : . :
rJMSF042I07+ TGGATCAACGGGCAAAGCATTGGTAGATATTGGACAATCCATGCAACCGGAGATTGCAAC
rJMFF036O01+ TGGATCAACGGGCAAAGCATTGGTAGATATTGGACAATCCATGCAACCGGAGATTGCAAC
rJMSF036J11+ TGGATCAACGGGCAAAGCATTGGTAGATATTGGACAATCCATGCAACCGGAGATTGCAAC
JMFS154G01- AGCATTGGTAGATATTGGACAATCCATGCAACCGGAGATTGCAAC
rJMFF028J05+ TGGATCAACGGGCAAAGCATTGGTAGATATTGGACAATCCATGCAACCGGAGATTGCAAC
                      ____________________________________________________________
consensus TGGATCAACGGGCAAAGCATTGGTAGATATTGGACAATCCATGCAACCGGAGATTGCAAC
 
. : . : . : . : . : . :
rJMSF042I07+ ACTTGTACATATGAAGGGACATACAGATCGCCAAAGTGCCAATCTGGTTGCGGACAACCT
rJMFF036O01+ ACTTGTACATATGAAGGGACATACAGATCGCCAAAGTGCCAATCTGGTTGCGGACAACCT
rJMSF036J11+ ACTTGTACATATGAAGGGACATACAGATCGCCAAAGTGCCAATCTGGTTGCGGACAACCT
JMFS154G01- ACTTGTACATATGAAGGGACATACAGATCGCCAAAGTGCCAATCTGGTTGCGGACAACCT
rJMFF028J05+ ACTTGTACATATGAAGGGACATACAGATCGCCAAAGTGCCAATCTGGTTGCGGACAACCT
                      ____________________________________________________________
consensus ACTTGTACATATGAAGGGACATACAGATCGCCAAAGTGCCAATCTGGTTGCGGACAACCT
 
. : . : . : . : . : . :
rJMSF042I07+ ACTCAACGATGGTACCACGTTCCTCGATCCTGGCTGAAACCAACAGGAAACCTGCTGGTA
rJMFF036O01+ ACTCAACGATGGTACCACGTTCCTCGATCCTGGCTGAAACCAACAGGAAACCTGCTGGTA
rJMSF036J11+ ACTCAACGATGGTACCACGTTCCTCGATCCTGGCTGAAACCAACAGGAAACCTGCTGGTA
JMFS154G01- ACTCAACGATGGTACCACGTTCCTCGATCCTGGCTGAAACCAACAGGAAACCTGCTGGTA
rJMFF028J05+ ACTCAACGATGGTACCACGTTCCTCGATCCTGGCTGAAACCAACAGGAAACCTGCTGGTA
                      ____________________________________________________________
consensus ACTCAACGATGGTACCACGTTCCTCGATCCTGGCTGAAACCAACAGGAAACCTGCTGGTA
 
. : . : . : . : . : . :
rJMSF042I07+ GTCTTTGAGGAGATAGGCGGAGATGCATCGAGAATCTCTGTCGTTAAAAGAACACTCACT
rJMFF036O01+ GTCTTTGAGGAGATAGGCGGAGATGCATCGAGAATCTCTGTCGTTAAAAGAACACTCACT
rJMSF036J11+ GTCTTTGAGGAGATAGGCGGAGATGCATCGAGAATCTCTGTCGTTAAAAGAACACTCACT
JMFS154G01- GTCTTTGAGGAGATAGGCGGAGATGCATCGAGAATCTCTGTCGTTAAAAGAACACTCACT
rJMFF028J05+ GTCTTTGAGGAGATAGGCGGAGATGCATCGAGAATCTCTGTCGTTAAAAGAACACTCACT
                      ____________________________________________________________
consensus GTCTTTGAGGAGATAGGCGGAGATGCATCGAGAATCTCTGTCGTTAAAAGAACACTCACT
 
. : . : . : . : . : . :
rJMSF042I07+ TACGTATAGAAAGAAATCATATTAAGATATTACTGTTAGTTTAGTTTTATTTATCTCTAA
rJMFF036O01+ TACGTATAGAAAGAAATCATATTAAGATATTACTGTTAGTTTAGTTTTATTTATCTCTAA
rJMSF036J11+ TACGTATAGAAAGAAATCATATTAAGATATTACTGTTAGTTTAGTTTTATTTATCTCTAA
JMFS154G01- TACGTATAGAAAGAAATCATATTAAGATATTACTGTTAGTTTAGTTTTATTTATCTCTAA
rJMFF028J05+ TACGTATAGAAAGAAATCATATTAAGATATTACTGTTAGTTTAGTTTTATTTATCTCTAA
                      ____________________________________________________________
consensus TACGTATAGAAAGAAATCATATTAAGATATTACTGTTAGTTTAGTTTTATTTATCTCTAA
 
. : . : . : . : . : . :
rJMSF042I07+ GAGCCAAAATTCACTGTTTTTACTCCCCTTTCTTTAGATCTTGGATTATGAAAGTTTTAG
rJMFF036O01+ GAGCCAAAATTCACTGTTTTTACTCCCCTTTCTTTAGATCTTGGATTATGAAAGTTTTAG
rJMSF036J11+ GAGCCAAAATTCACTGTTTTTACTCCCCTTTCTTTAGATCTTGGATTATGAAAGTTTTAG
JMFS154G01- GAGCCAAAATTTACTGTTTTTACTCCCCTTTCTTTAGATCTTGGATTATGAAAGTTTTAG
rJMFF028J05+ GAGCCAAAATTCACTGTTTTTACTCCCCTTTCTTTAGATCTTGGATTATGAAAGTTTTAG
                      ____________________________________________________________
consensus GAGCCAAAATTCACTGTTTTTACTCCCCTTTCTTTAGATCTTGGATTATGAAAGTTTTAG
 
. : . : . : . : . : . :
rJMSF042I07+ TCATAGTACATACAGGAAAGATGTAGTTGAAGACTACTATTCCAGTCTATTTAAATTGGA
rJMFF036O01+ TCATAGTACATACAGGAAAGATGTAGTTGAAGACTACTATTCCAGTCTATTTAAATTGGA
rJMSF036J11+ TCATAGTACATACAGGAAAGATGTAGTTGAAGACTACTATTCCAGTCTATTTAAATTGGA
JMFS154G01- TCATAGTACATACAGGAAAGATGTAGTTGAAGACTACTATTCCAGTCTATTTAAATTGGA
rJMFF028J05+ TCATAGTACATACAGGAAAGATGTAGTTGAAGACTACTATTCCAGTCTATTTAAATTGGA
                      ____________________________________________________________
consensus TCATAGTACATACAGGAAAGATGTAGTTGAAGACTACTATTCCAGTCTATTTAAATTGGA
 
. : . : . : . : . : . :
rJMSF042I07+ AGAAGATTATGATAAGGTGGCATATCTGTATAGACAGGATACATTGCCCAGAAACACCAC
rJMFF036O01+ AGAAGATTATGATAAGGTGGCATATCTGTATAGACAGGATACATTGCCCAGAAACACCAC
rJMSF036J11+ AGAAGATTATGATAAGGTGGCATATCTGTATAGACAGGATACATTGCCCAGAAACACCAC
JMFS154G01- AGAAGATTATGATAAGGTGGCATATCTGTATAGACAGGATACATTGCCCAGAAACACCAC
rJMFF028J05+ AGAAGATTATGATAAGGTGGCATATCTGTATAGACAGGATACATTGCCCAGAAACACCAC
                      ____________________________________________________________
consensus AGAAGATTATGATAAGGTGGCATATCTGTATAGACAGGATACATTGCCCAGAAACACCAC
 
. : . : . : . : . : . :
rJMSF042I07+ TTACAGTCATACTAGGTACGAGGTGGGATTCGAACCGGAAACGCCGACTTCGACAAGATT
rJMFF036O01+ TTACAGTCATACTAGGTACGAGGTGGGATTCGAACCGGAAACGCCGACTTCGACAAGATT
rJMSF036J11+ TTACAGTCATACTAGGTACGAGGTGGGATTCGAACCGGAAACGCCGACTTCGACAAGATT
JMFS154G01- TTACAGTCATACTAGGTACGAGGTGGGATTCGAACCGGAAACGCCGACTTCGACAAGATT
rJMFF028J05+ TTACAGTCATACTAGGTACGAGGTGGGATTCGAACCGGAAACGCCGACTTCGACAAGATT
                      ____________________________________________________________
consensus TTACAGTCATACTAGGTACGAGGTGGGATTCGAACCGGAAACGCCGACTTCGACAAGATT
 
. : . : . : . : . : . :
rJMSF042I07+ CAAATGTCAACTCGAATGTTGGTACGATGTAACTCGTGTTAAAGGGTTAATTATATTCTA
rJMFF036O01+ CAAATGTCAACTCGAATGTTGGTACGATGTAACTCGTGTTAAAGGGTTAATTATATTCTA
rJMSF036J11+ CAAATGTCAACTCGAATGTTGGTACGATGTAACTCGTGTTAAAGGGTTAATTATATTCTA
JMFS154G01- CAAATGTCAACTCGAATGTTGGTACGATGTAACTCGTGTTAAAGGGTTAATTATATTCTA
rJMFF028J05+ CAAATGTCAACTCGAATGTTGGTACGATGTAACTCGTGTTAAAGGGTTAATTATATTCTA
                      ____________________________________________________________
consensus CAAATGTCAACTCGAATGTTGGTACGATGTAACTCGTGTTAAAGGGTTAATTATATTCTA
 
. : . : . : . : . : . :
rJMSF042I07+ GTGTGGAGCTTTAATTATGTGAGTGTCTTGGTCTAATTTTATGCATAAATTAT
rJMFF036O01+ GTGTGGAGCTTTAATTATGTGAGTGTCTTGGTCTAA
rJMSF036J11+ GTGTGGAGCTTTAATTATGTGAGTGTCTTGGTCTAATTTTATGCATAAATTAT
JMFS154G01- GTGTGGAGCTTTAATT
rJMFF028J05+ GTGTGGAGCTTTAATTATGTGAGTGTCTTGGTCTAATTTTATGCATAAATTATTGATTAT
                      ____________________________________________________________
consensus GTGTGGAGCTTTAATTATGTGAGTGTCTTGGTCTAATTTTATGCATAAATTATTGATTAT