Previous Contig 009548:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028G11Sequence526006371 (13)gb:AF462857_18019661e-22Arabidopsis thaliana At1g29350/F15D2_27 mRNA, complete cds.300009548 (7)
JMFS167D03Sequence587009548 (7)gb:AY063854_15658027e-30Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680
JMSF026F23Sequence656006371 (13)gb:AF462857_18019669e-24Arabidopsis thaliana At1g29350/F15D2_27 mRNA, complete cds.677009548 (7)gb:AY063854_15658022e-30Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680
JMSF027B21Sequence681006371 (13)gb:AY063854_15658023e-27Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680671009548 (7)gb:AY063854_15658023e-28Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680
JMSF043I04Sequence751006371 (13)gb:AY063854_15658022e-36Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680639009548 (7)gb:AY063854_15658023e-26Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680
JMSF050K22Sequence693006371 (13)gb:AY063854_15658021e-29Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680765009548 (7)gb:AY063854_15658021e-36Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680
JMSF052M01Sequence666006371 (13)gb:AY063854_15658024e-25Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680912009548 (7)gb:AY063854_15658023e-58Arabidopsis thaliana unknown protein (At1g29370) mRNA, complete cds.>gb:AY096680

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052M01+ GCTCTACCGCAACACCTTGCTGTGCATCCATATTCTCAACCGACGCTTC
                      ____________________________________________________________
consensus GCTCTACCGCAACACCTTGCTGTGCATCCATATTCTCAACCGACGCTTC
 
. : . : . : . : . : . :
rJMSF052M01+ CTTTGGGACCTTTTGCAAACATAATTAGCTATCCTTTTATGCATCAGAGCTATACATATA
                      ____________________________________________________________
consensus CTTTGGGACCTTTTGCAAACATAATTAGCTATCCTTTTATGCATCAGAGCTATACATATA
 
. : . : . : . : . : . :
rJMSF052M01+ TGCCTCCGGGTTTCCAACAACCATTTGCTGGTAACAGTACTTACCAACAGTCTCTGGCAG
rJMSF050K22+ GGCAG
                      ____________________________________________________________
consensus TGCCTCCGGGTTTCCAACAACCATTTGCTGGTAACAGTACTTACCAACAGTCTCTGGCAG
 
. : . : . : . : . : . :
rJMSF052M01+ CAGTGCTCCCGAACTACAAGAACAGCGTATCAGTAAGCAGCTTGCCTCACTCTGCTACTG
rJMSF050K22+ CAGTGCTCCCGAACTACAAGAACAGCGTATCAGTAAGCAGCTTGCCTCACTTTGCTACTG
                      ____________________________________________________________
consensus CAGTGCTCCCGAACTACAAGAACAGCGTATCAGTAAGCAGCTTGCCTCACTTTGCTACTG
 
. : . : . : . : . : . :
rJMSF052M01+ TTCCTTCAGGATACGGTGCCTTTGGAAACACCGGCACAATTCCTGGGAGCTTCCCGTTGA
JMFS167D03- CGGTGCCTTTGGAAACACCGGCACAATTCCTGGGAGCTTCCCGTTGA
rJMSF026F23+ TTCAGGATACGGTGCCTTTGGAAACACCGGCACAATTCCTGGGAGCTTCCCGTTGA
rJMSF050K22+ TTCCTTCAGGATACGGTGCCTTTGGAAACACCGGCACAATTCCTGGGAGCTTCCCGTTGA
rJMSF027B21+ CTTCCCGTTGA
                      ____________________________________________________________
consensus TTCCTTCAGGATACGGTGCCTTTGGAAACACCGGCACAATTCCTGGGAGCTTCCCGTTGA
 
. : . : . : . : . : . :
rJMSF052M01+ ATCCTTCTGCTGCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
JMFS167D03- ATCCTTCTGCTGCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
rJMSF026F23+ ATCCTTCTGCTGCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
rJMSF050K22+ ATCCTTCTGCTGCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
rJMSF043I04+ GCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
rJMSF027B21+ ATCCTTCTGCTGCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
                      ____________________________________________________________
consensus ATCCTTCTGCTGCTCCGAGTACATCTTTGGGTATTGATGACGGGCTTAGTTCTCAATACA
 
. : . : . : . : . : . :
rJMSF052M01+ AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
JMFS167D03- AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
rJMSF026F23+ AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
rJMSF050K22+ AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
rJMSF043I04+ AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
rJMSF027B21+ AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
                      ____________________________________________________________
consensus AGGACAACCATCATTTAATGTCTCTTCAACAGGTTGAGAATTCAGGTATGTGGCTCCACG
 
. : . : . : . : . : . :
rJMSF052M01+ GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
JMFS167D03- GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
rJMSF026F23+ GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
rJMSF050K22+ GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
rJMSF043I04+ GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
rJMSF027B21+ GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
                      ____________________________________________________________
consensus GCCATGGCTCCCGAACAATGTCAGCTGCTCCTGCCAATACATACTACAATATCCAGGCGC
 
. : . : . : . : . : . :
rJMSF052M01+ AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCATCTCAAAACTATGCATCGT
JMFS167D03- AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCATCTCAAAACTATGCATCGT
rJMSF026F23+ AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCATCTCAAAACTATGCATCGT
rJMSF050K22+ AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCATCTCAAAACTATGCATCGT
rJMSF043I04+ AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCACCTCAAAACTATGCATCGT
rJMSF027B21+ AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCATCTCAAAACTATGCATCGT
                      ____________________________________________________________
consensus AAAACCAGCAACCCAGTGGCTTCCGGCAAGTTCAACAGCCATCTCAAAACTATGCATCGT
 
. : . : . : . : . : . :
rJMSF052M01+ TGGGCTACAACCCAAACTTCTACCATTCCCAAACCGGGATCTCGCTGGACCACCACCACC
JMFS167D03- TGGGCTACAACCCAAACTTCTACCATTCCCAAACCGGGATCTCGCTGGACCACCACCACC
rJMSF026F23+ TGGGCTACAACCCAAACTTCTACCATTCCCAAACCGGGATCTCGCTGGACCACCACCACC
rJMSF050K22+ TGGGCTACAACCCAAACTTCTACCATTCCCAAACCGGGATCTCGCTGGACCACCACCACC
rJMSF043I04+ TGGGCTACAACCCAAACTTCTACCATTCCCAAACTGGGATCTCGCTGGACCACCACCACC
rJMSF027B21+ TGGGCTACAACCCAAACTTCTACCATTCCCAAACCGGGATCTCGCTGGACCACCACCACC
                      ____________________________________________________________
consensus TGGGCTACAACCCAAACTTCTACCATTCCCAAACCGGGATCTCGCTGGACCACCACCACC
 
. : . : . : . : . : . :
rJMSF052M01+ AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
JMFS167D03- AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
rJMSF026F23+ AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
rJMSF050K22+ AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
rJMSF043I04+ AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
rJMSF027B21+ AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
                      ____________________________________________________________
consensus AGCAGCAGAACCCTAGAGACGGCCCGTTGGGCGGCGGTGGCGGCAACGCTCAAGTCCAGC
 
. : . : . : . : . : . :
rJMSF052M01+ CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
JMFS167D03- CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
rJMSF026F23+ CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
rJMSF050K22+ CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
rJMSF043I04+ CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
rJMSF027B21+ CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
                      ____________________________________________________________
consensus CTAAGCCATCATCCCAACAGCTGTGGCAAAACAGCTACTAATCTTACTCCCTCCCTACTC
 
. : . : . : . : . : . :
rJMSF052M01+ CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
JMFS167D03- CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
rJMSF026F23+ CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
rJMSF050K22+ CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
rJMSF043I04+ CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
rJMSF027B21+ CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
rJMFF028G11+ TAGTGCATCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
                      ____________________________________________________________
consensus CCTAGTGCCTCCGGGTTTTTCAGGGTTTGTAATGATAAAGAAGTTGCCCCTCAAGCTTGT
 
. : . : . : . : . : . :
rJMSF052M01+ GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
JMFS167D03- GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
rJMSF026F23+ GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
rJMSF050K22+ GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
rJMSF043I04+ GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
rJMSF027B21+ GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
rJMFF028G11+ GGCCGCGGCAATAATCCATATTTTCGACGCNCAAAGCTTGTGTGGNGGCTGCCCTGTACT
                      ____________________________________________________________
consensus GGCCGCGGCAATAATCCATATTTTCGACGCCCAAAGCTTGTGTGGCTGCTGCCCTGTACT
 
. : . : . : . : . : . :
rJMSF052M01+ TAGAGTCTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
rJMSF026F23+ TAGAGTCTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
rJMSF050K22+ TAGAGTCTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
rJMSF043I04+ TAGAGTCTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
rJMSF027B21+ TAGAGTCTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
rJMFF028G11+ TAGAGTNTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
                      ____________________________________________________________
consensus TAGAGTCTTAGAGGTTGTATTTTACGTTTTCTTTCCGTTATATCATCAGTTAATGTAGTA
 
. : . : . : . : . : . :
rJMSF052M01+ TAGGGATATGCAAG
rJMSF026F23+ TAGGGATATGCAAGCTAAGTT
rJMSF050K22+ TAGGGATATGCAAGCTAAGTTGGTGTTAGTGGGATTCT
rJMSF043I04+ TAGGGATATGCAAGCTAAGTTGGTGTTAGTGGGATTCTTGTGCTTCTGTT
rJMSF027B21+ TAGGGATATGCAAGCTAAGTTGGTGTTAGTGGGATTCTTGTGCTTCTGTTTGAATTTT
rJMFF028G11+ TAGGGATATGCAAGNTAAGTTGGTGTTAGTGGGATTCTTGTGCTTCTGTTTGAATTTTTC
                      ____________________________________________________________
consensus TAGGGATATGCAAGCTAAGTTGGTGTTAGTGGGATTCTTGTGCTTCTGTTTGAATTTTTC
 
. : . : . : . : . : . :
rJMFF028G11+ CTTTTTTCTTCCCCCTCNCAGTTATCAACAACATCCTGCTCCTATACCCACCCTCTGCNC
                      ____________________________________________________________
consensus CTTTTTTCTTCCCCCTCNCAGTTATCAACAACATCCTGCTCCTATACCCACCCTCTGCNC