Previous Contig 009546:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007J13Sequence520001318 (3)323009546 (3)pir|C84889|C848893e-19hypothetical protein At2g45330 [imported] - Arabidopsis thaliana>gb:AX366211_146
JMFF028F07Sequence489001318 (3)gb:AP002542_18226400.010Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P067415009546 (3)pir|C84889|C848895e-21hypothetical protein At2g45330 [imported] - Arabidopsis thaliana>gb:AX366211_146
JMSF001N24Sequence371001318 (3)688009546 (3)pir|C84889|C848898e-42hypothetical protein At2g45330 [imported] - Arabidopsis thaliana>gb:AX366211_146

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001N24+ CCAATGAATATATAAAAATGATGGNGGTGTCNGTAATTATGGGTATAT
                      ____________________________________________________________
consensus CCAATGAATATATAAAAATGATGGNGGTGTCNGTAATTATGGGTATAT
 
. : . : . : . : . : . :
rJMSF001N24+ GCAATTTTAAATTTTTATTCCCTCTGGTGTGCATTCGAATTAATGTTTTATGCAAGATTG
                      ____________________________________________________________
consensus GCAATTTTAAATTTTTATTCCCTCTGGTGTGCATTCGAATTAATGTTTTATGCAAGATTG
 
. : . : . : . : . : . :
rJMSF001N24+ AGTTACCCTTCTCTGCTGGAATGACATGTAATAGACGGTTGAAACTGAAAGCTTGTTGAA
                      ____________________________________________________________
consensus AGTTACCCTTCTCTGCTGGAATGACATGTAATAGACGGTTGAAACTGAAAGCTTGTTGAA
 
. : . : . : . : . : . :
rJMSF001N24+ ACCAATCCNTTCAGCTGAAGAAGTTCCNGTGTGNGTCCNTGGGNCCTACNAGAAGAATTT
                      ____________________________________________________________
consensus ACCAATCCNTTCAGCTGAAGAAGTTCCNGTGTGNGTCCNTGGGNCCTACNAGAAGAATTT
 
. : . : . : . : . : . :
rJMSF001N24+ GGAACTGATTTTGGAGCAAGGCCTCNAACGCNTGAAAAGGTTACATGTTCNCTTCTCACG
                      ____________________________________________________________
consensus GGAACTGATTTTGGAGCAAGGCCTCNAACGCNTGAAAAGGTTACATGTTCNCTTCTCACG
 
. : . : . : . : . : . :
rJMSF001N24+ TGGCTTACCNACNGATGGNGAAGTAATTAGTGGAATGAGGCGAGATGTCAATATCCTAAT
rJMFF007J13+ GATGGTGAAGTNATTNGTGGAATGAGGNGAGATGTCAATATCCTAAT
rJMFF028F07+ GATGGNGAAGTAATTAGTGGAATGAGGGGAGATGTCAATATCCTAAT
                      ____________________________________________________________
consensus TGGCTTACCNACNGATGGTGAAGTAATTAGTGGAATGAGGGGAGATGTCAATATCCTAAT
 
. : . : . : . : . : . :
rJMSF001N24+ CTTTCTGGATGTCAAAAAAGCTCTAGAAGAAGGAATGAAGCTTTACATCTNTGATAATAA
rJMFF007J13+ NTTTTTGGANGTCAAAAAAGCTTTNGAAGAAGGAANGAAGCTTTACATNTTTGATAATAA
rJMFF028F07+ NTTTTTGGANGTCAAAAAAGCTTTAGAAGAAGGAANGAAGCTTTACATNTNTGATAATAA
                      ____________________________________________________________
consensus CTTTTTGGATGTCAAAAAAGCTTTAGAAGAAGGAATGAAGCTTTACATCTTTGATAATAA
 
. : . : . : . : . : . :
rJMSF001N24+ GGTCATATTGACAGAGGGTTTTGATGGTGTAGTGCCNGTGAAGTACTTCAAGAAAATTGA
rJMFF007J13+ GGTCATATTGACAGAGGGTTTTGATGGNGTAGTGCCAGTGAAGTNCTTCAAGAAAANTGA
rJMFF028F07+ GGTCATATTGACAGAGGGTTTTGATGGTGTAGTGCCNGTGAAGTNCTTCAAGAAAATTGA
                      ____________________________________________________________
consensus GGTCATATTGACAGAGGGTTTTGATGGTGTAGTGCCAGTGAAGTACTTCAAGAAAATTGA
 
. : . : . : . : . : . :
rJMSF001N24+ ATCNTGGCCAGATAGAAAATCCNTCTCNTTTCCNGTTGATTAACCTTGGNTTCCTCC-NT
rJMFF007J13+ ATCATGGCCAGATAGAAAATCCNTNTCATTTCCAGTTGATTAACCTTGGATTCCTCCNTT
rJMFF028F07+ ATCATGGCCAGATAGAAAATCCATNTCATTTCCAGTTGATTAACCTTGGATTCCTCC-AT
                      ____________________________________________________________
consensus ATCATGGCCAGATAGAAAATCCATCTCATTTCCAGTTGATTAACCTTGGATTCCTCC-TT
 
. : . : . : . : . : . :
rJMSF001N24+ TTTTTTTTTGAATTTTTATCTTTTACTGTTTATTGAAGTTGAGACATTCAATCAAGAGTC
rJMFF007J13+ TTTTTTTTTGAATTTTTATCTTTTACTGTTTATTGAAGTTGAGACATTCAATCTAGAGTC
rJMFF028F07+ TTTTTTTTTGAATTTTTATCTTTTACTGTTTATTGAAGTTGAGACATTCAATCAAGAGTC
                      ____________________________________________________________
consensus TTTTTTTTTGAATTTTTATCTTTTACTGTTTATTGAAGTTGAGACATTCAATCAAGAGTC
 
. : . : . : . : . : . :
rJMSF001N24+ ACAAGTTTAGACAACTATAGTAAAAGGTCTTTGACATATGTTTTGAACCATGATGTTTGT
rJMFF007J13+ ACAAGTTTAGACAACTATAGTAAAAGGTCT
rJMFF028F07+ ACAAGTTTAGACAACTATAGTAAAAGGTCTTTGACATATGTTTTGAACCATGATGTTTGT
                      ____________________________________________________________
consensus ACAAGTTTAGACAACTATAGTAAAAGGTCTTTGACATATGTTTTGAACCATGATGTTTGT
 
. : . : . : . : . : . :
rJMSF001N24+ CATACTTTAAAAGCCTGCCTTGTATACTGCTT
rJMFF028F07+ CATACTTTAAAAGCCTGCCTTGTATACTGCTTTAGACCCAATTACATAAACAATATGAAG
                      ____________________________________________________________
consensus CATACTTTAAAAGCCTGCCTTGTATACTGCTTTAGACCCAATTACATAAACAATATGAAG