Previous Contig 009541:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028C08Sequence577007698 (3)gb:AF177590_17746463e-51Vitis vinifera ornithine aminotransferase mRNA, complete cds.688009541 (3)gb:AF177590_17746464e-52Vitis vinifera ornithine aminotransferase mRNA, complete cds.
JMFF031I14Sequence522007698 (3)gb:AF177590_17746463e-58Vitis vinifera ornithine aminotransferase mRNA, complete cds.658009541 (3)gb:AF177590_17746463e-51Vitis vinifera ornithine aminotransferase mRNA, complete cds.
JMSF045P23Sequence729007698 (3)gb:AB006698_15098741e-71Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCL19.728009541 (3)gb:AF177590_17746469e-74Vitis vinifera ornithine aminotransferase mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF045P23+ CTGATGTCATAATATNGGGAAAAGCGTTGGGTGGTGGAGT
                      ____________________________________________________________
consensus CTGATGTCATAATATNGGGAAAAGCGTTGGGTGGTGGAGT
 
. : . : . : . : . : . :
rJMSF045P23+ GTTACCTGTAAGTGCAGTGCTAGCAGACAAAGATGTTATGCTTTGTATTCAGCCCGGAGA
                      ____________________________________________________________
consensus GTTACCTGTAAGTGCAGTGCTAGCAGACAAAGATGTTATGCTTTGTATTCAGCCCGGAGA
 
. : . : . : . : . : . :
rJMSF045P23+ GCATGGAAGTACTTTCGGGGGGAATCCTTTGGCCAGCGCTGTTGGCATTGCGTCTCTAGA
rJMFF031I14+ GCTGTTGGCATTGCGTCTCTAGA
rJMFF028C08+ GCTGTTGGCATTGCGTCTCTAGA
                      ____________________________________________________________
consensus GCATGGAAGTACTTTCGGGGGGAATCCTTTGGCCAGCGCTGTTGGCATTGCGTCTCTAGA
 
. : . : . : . : . : . :
rJMSF045P23+ CGTGATAAGAGATGAAGGACTTGCAGAGAGATCTGCTGAGATGGGAGAGCAGCTGAGGCA
rJMFF031I14+ CGTGATAAGAGATGAAGGACTTGCAGAGAGATCTGCTGAGATGGGAGAGCAGCTGAGGCA
rJMFF028C08+ CGTGATAAGAGATGAAGGACTTGCAGAGAGATCTGCTGAGATGGGAGAGCAGCTGAGGCA
                      ____________________________________________________________
consensus CGTGATAAGAGATGAAGGACTTGCAGAGAGATCTGCTGAGATGGGAGAGCAGCTGAGGCA
 
. : . : . : . : . : . :
rJMSF045P23+ GCAGCTAACGAAGATTCAGCAGCGGTTTCCTGAAATCATAAAGGAAATTCGAGGAAGAGG
rJMFF031I14+ GCAGCTAACGAAGATTCAGCAGCGGTTTCCTGAAATCATAAAGGAAATTCGAGGAAGAGG
rJMFF028C08+ GCAGCTAACGAAGATTCAGCAGCGGTTTCCTGAAATCATAAAGGAAATTCGAGGAAGAGG
                      ____________________________________________________________
consensus GCAGCTAACGAAGATTCAGCAGCGGTTTCCTGAAATCATAAAGGAAATTCGAGGAAGAGG
 
. : . : . : . : . : . :
rJMSF045P23+ GTTGTTCAACGCGGTAGAGCTGAACAGCAAGGCCTTGTTTCCCGTGACTGCTTACGACGT
rJMFF031I14+ GTTGTTCAACGCGGTAGAGCTGAACAGCAAGGCCTTGTTTCCCGTGACTGCTTACGACGT
rJMFF028C08+ GTTGTTCAACGCGGTAGAGCTGAACAGCAAGGCCTTGTTTCCCGTGACTGCTTACGACGT
                      ____________________________________________________________
consensus GTTGTTCAACGCGGTAGAGCTGAACAGCAAGGCCTTGTTTCCCGTGACTGCTTACGACGT
 
. : . : . : . : . : . :
rJMSF045P23+ ATGCCTAAAGCTGAAGGAGAGAGGGATTCTTGCCAAGCCAACTCATGATACTATAATACG
rJMFF031I14+ ATGCCTAAAGCTGAAGGAGAGAGGGATTCTTGCCAAGCCAACTCATGATACTATAATACG
rJMFF028C08+ ATGCCTAAAGCTGAAGGAGAGAGGGATTCTTGCCAAGCCAACTCATGATACTATAATACG
                      ____________________________________________________________
consensus ATGCCTAAAGCTGAAGGAGAGAGGGATTCTTGCCAAGCCAACTCATGATACTATAATACG
 
. : . : . : . : . : . :
rJMSF045P23+ TTTGACGCCCCCTCTTTCAATGAGTGACCATGAGCTTCGGCAAGGCTCAGAGGCATTGCA
rJMFF031I14+ TTTGACGCCCCCTCTTTCAATGAGTGACCATGAGCTTCGGCAAGGCTCAGAGGCATTGCA
rJMFF028C08+ TTTGACGCCCCCTCTTTCAATGAGTGACCATGAGCTTCGGCAAGGCTCAGAGGCATTGCA
                      ____________________________________________________________
consensus TTTGACGCCCCCTCTTTCAATGAGTGACCATGAGCTTCGGCAAGGCTCAGAGGCATTGCA
 
. : . : . : . : . : . :
rJMSF045P23+ CGACGTTTTGGAGCTCGATCTACCAAAGATGCAGAAAGAAAAGCCAATGACGCAATCCCA
rJMFF031I14+ CGACGTTTTGGAGCTCGATCTACCAAAGATGCAGAAAGAAAAGCCAATGACGCAATCCCA
rJMFF028C08+ CGACGTTTTGGAGCTCGATCTACCAAAGATGCAGAAAGAAAAGCCAATGACGCAATCCCA
                      ____________________________________________________________
consensus CGACGTTTTGGAGCTCGATCTACCAAAGATGCAGAAAGAAAAGCCAATGACGCAATCCCA
 
. : . : . : . : . : . :
rJMSF045P23+ TGCTGCATCTGTAAATGTATGTGACCGGTGTGGGCGCAATTTGTAATCTGCTGTGAATGA
rJMFF031I14+ TGCTGCATCTGTAAATGTATGTGACCGGTGTGGGCGCAATTTGTAATCTGCTGTGAATGA
rJMFF028C08+ TGCTGCATCTGTAAATGTATGTGACCGGTGTGGGCGCAATTTGTAATCTGCTGTGAATGA
                      ____________________________________________________________
consensus TGCTGCATCTGTAAATGTATGTGACCGGTGTGGGCGCAATTTGTAATCTGCTGTGAATGA
 
. : . : . : . : . : . :
rJMSF045P23+ TGTGAGTCATAAGAATTGCAAGAATGTGGATTACAATAAAAAAGGAGGATGGGAAAAAGA
rJMFF031I14+ TGTGAGTCATAAGAATTGCAAGAATGTGGATTACAATAAAAAAGGAGGATGGAAAAAAGA
rJMFF028C08+ TGTGAGTCATAAGAATTGCAAGAATGTGGATTACAATAAAAAAGGAGGATGGGAAAAAGA
                      ____________________________________________________________
consensus TGTGAGTCATAAGAATTGCAAGAATGTGGATTACAATAAAAAAGGAGGATGGGAAAAAGA
 
. : . : . : . : . : . :
rJMSF045P23+ GTTACAACTCCTTTGAATGGGGTGTATTAGTGAAGAAAATTAGGTTGCCTAGACCAGTAC
rJMFF031I14+ GTTACAACTCCTTTGAATGGGGTGTATTAGTGAAGAAAATTAGGTTGCCTAGACCAGTAC
rJMFF028C08+ GTTACAACTCCTTTGAATGGGGTGTATTAGTGAAGAAAATTAGGTTGCCTAGACCAGTAC
                      ____________________________________________________________
consensus GTTACAACTCCTTTGAATGGGGTGTATTAGTGAAGAAAATTAGGTTGCCTAGACCAGTAC
 
. : . : . : . : . : . :
rJMSF045P23+ ATTTGAAAAATTCTGTTGTATTTTGCCC
rJMFF031I14+ ATTTGAAAAA-TCTGTTGTATTTTGCCCCATGTTGACATGTGAAGAAAATTACTATTCTT
rJMFF028C08+ ATTTGAAAAA-TCTGTTGTATTTTGCCCCATGTTGACATGTGAAGAAAATTACTATTCTT
                      ____________________________________________________________
consensus ATTTGAAAAA-TCTGTTGTATTTTGCCCCATGTTGACATGTGAAGAAAATTACTATTCTT
 
. : . : . : . : . : . :
rJMFF031I14+ GTGTTCAGAACCCCCTAACAAAGTTGGTTAAACAAT
rJMFF028C08+ GTGTTCAGAACCCCCTAACAAAGTTGGTTAAACAATTAGCTTGATAACTGCTCAAGTTCG
                      ____________________________________________________________
consensus GTGTTCAGAACCCCCTAACAAAGTTGGTTAAACAATTAGCTTGATAACTGCTCAAGTTCG