Previous Contig 009538:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001C19Sequence594009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.605009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF003F15Sequence582009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.642009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF004B10Sequence590009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.673009538 (42)gb:CR382137_16704190.006Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF005B11Sequence599009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.627009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF008O09Sequence590009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.677009538 (42)gb:CR382137_16704190.006Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF011I12Sequence585009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.649009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF014C07Sequence586009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.616009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF015K10Sequence589009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.586009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF018N02Sequence591009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.648009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF018P08Sequence591009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.648009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF024M24Sequence540009538 (42)gb:CR382137_16704190.003Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.655009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF028A20Sequence584009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.661009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF029H09Sequence500009538 (42)gb:CR382137_16704190.003Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.657009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF031C17Sequence594009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.656009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFF031I13Sequence569009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.673009538 (42)gb:CR382137_16704190.006Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN006B19Sequence641009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN011F02Sequence624009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN012D18Sequence617009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN013E07Sequence631009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN017O17Sequence592009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN025L17Sequence618009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN031L21Sequence618009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN032B07Sequence546009538 (42)gb:CR382137_16704190.004Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN040G17Sequence628009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN040I23Sequence612009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN041D08Sequence634009538 (42)gb:CR382137_16704190.005Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii.
JMFN045B23Sequence359009538 (42)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF005B11+ ATTATATTATTAAGGATT
rJMFF005B11- CACTATTATTTTAACTTATTATATTATTAAGGATT
rJMFF024M24- ATTATTAAGGATT
rJMFF011I12- ATTATTAAGGATT
JMFN025L17+ GGATT
rJMFF003F15- TATTAAGGATT
rJMFF001C19- GGATT
rJMFF014C07- TATTATTAAGGATT
rJMFF015K10- ATTATTAAGGATT
JMFN006B19+ TATTATTAAGGATT
JMFN041D08+ TATTATTAAGGA-T
rJMFF004B10- ACTTATTATATTATTAAGGATT
rJMFF029H09- TTATTAAGGATT
rJMFF031C17- TATTAAGGATT
rJMFF018N02- ATT
rJMFF018P08- ATT
JMFN040I23+ AACTTATTATATTATTAAGGATT
JMFN011F02+ TTAACTTATTATATTATTAAGGATT
JMFN013E07+ ATTTTAACTTATTATATTATTAAGGATT
JMFN032B07+ ATTTTAACTTATTATATTATTAAGGATT
JMFN045B23+ ATTTTAACTTATTATATTATTAAGGATT
JMFN012D18+ ATTTTAACTTATTATATTATTAAGGATT
rJMFF008O09- ATTTTAACTTATTATATTATTAAGGATT
rJMFF031I13- TATTATTAAGGATT
rJMFF028A20- GATT
                      ____________________________________________________________
consensus CACTATTATTTTAACTTATTATATTATTAAGGATT
 
. : . : . : . : . : . :
JMFF005B11+ TGAGT-GCGGAGAAACACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF005B11- TGAGT-GCGGAGAAACACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF024M24- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF011I12- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN025L17+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN031L21+ GGAGAAATACATATTACCATCCACTAATCCTAGCTNGTATCCAATCTACTAG
JMFN040G17+ GGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF003F15- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF001C19- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN017O17+ AGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF014C07- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF015K10- TGAGT-GCGGAG-AATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN006B19+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN041D08+ TGAGTNGCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF004B10- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF029H09- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF031C17- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF018N02- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
rJMFF018P08- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN040I23+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN011F02+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN013E07+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN032B07+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN045B23+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFN012D18+ TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFF004B10+ ACTAG
JMFF011I12+ TCTACTAG
JMFF003F15+ AATCTACTAG
rJMFF008O09- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFF001C19+ TCTACTAG
JMFF031C17+ TCTACTAG
JMFF018N02+ ACTAG
JMFF018P08+ ACTAG
JMFF008O09+ CTAG
JMFF015K10+ TAG
rJMFF031I13- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
JMFF028A20+ G
rJMFF028A20- TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
                      ____________________________________________________________
consensus TGAGT-GCGGAGAAATACATATTACCATCCACTAATCCTAGCTTGTATCCAATCTACTAG
 
. : . : . : . : . : . :
JMFF005B11+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF005B11- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF024M24- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF011I12- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN025L17+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN031L21+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN040G17+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF003F15- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF001C19- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN017O17+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF014C07- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF015K10- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN006B19+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN041D08+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF004B10- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF029H09- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF031C17- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF018N02- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF018P08- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN040I23+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN011F02+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN013E07+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN032B07+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN045B23+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFN012D18+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF004B10+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF011I12+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF003F15+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF031I13+ GGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF024M24+ ATTGAGATAGCCAAATG
rJMFF008O09- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF001C19+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF031C17+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF018N02+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF018P08+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF008O09+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF015K10+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF014C07+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF031I13- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
JMFF028A20+ TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
rJMFF028A20- TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
                      ____________________________________________________________
consensus TCATGGATATTATTTTGGTAAGAAAATAGGTAAAAACACTTAAATTGAGATAGCCAAATG
 
. : . : . : . : . : . :
JMFF005B11+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF005B11- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF024M24- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF011I12- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN025L17+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN031L21+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN040G17+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF003F15- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF001C19- GAGACATTTAGCANCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN017O17+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF014C07- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF015K10- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN006B19+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN041D08+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF004B10- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF029H09- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF031C17- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF018N02- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF018P08- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN040I23+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN011F02+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN013E07+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN032B07+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN045B23+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFN012D18+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF004B10+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF011I12+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF003F15+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF031I13+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF024M24+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF008O09- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF001C19+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF031C17+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF018N02+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF018P08+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF008O09+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF015K10+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF014C07+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF029H09+ GGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF031I13- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
JMFF028A20+ GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
rJMFF028A20- GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
                      ____________________________________________________________
consensus GAGACATTTAGCAGCAAACCCATGCTGGTTGGATGAAGGGAGGTGCCATGGTTGCACTCA
 
. : . : . : . : . : . :
JMFF005B11+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF005B11- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF024M24- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF011I12- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN025L17+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN031L21+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN040G17+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF003F15- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF001C19- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN017O17+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF014C07- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTCCGTTGTTGTTACC
rJMFF015K10- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN006B19+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN041D08+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF004B10- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF029H09- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF031C17- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF018N02- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF018P08- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN040I23+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN011F02+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN013E07+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN032B07+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN045B23+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFN012D18+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF004B10+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF011I12+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF003F15+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF031I13+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF024M24+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF008O09- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF001C19+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF031C17+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF018N02+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF018P08+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF008O09+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF015K10+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF014C07+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTCCGTTGTTGTTACC
JMFF029H09+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF031I13- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
JMFF028A20+ TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
rJMFF028A20- TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
                      ____________________________________________________________
consensus TTTGCTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATCTTCGTTGTTGTTACC
 
. : . : . : . : . : . :
JMFF005B11+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF005B11- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF024M24- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF011I12- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN025L17+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN031L21+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN040G17+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF003F15- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF001C19- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN017O17+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF014C07- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF015K10- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN006B19+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN041D08+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF004B10- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF029H09- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF031C17- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF018N02- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF018P08- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN040I23+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN011F02+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN013E07+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN032B07+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN045B23+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFN012D18+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF004B10+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF011I12+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF003F15+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF031I13+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF024M24+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF008O09- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF001C19+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF031C17+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF018N02+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF018P08+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF008O09+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF015K10+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF014C07+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF029H09+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF031I13- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
JMFF028A20+ AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
rJMFF028A20- AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
                      ____________________________________________________________
consensus AACCATATCTTCATCACCGTTTTTTATGTCGTCGTCCTTGTCATTGTCATAAACAATATC
 
. : . : . : . : . : . :
JMFF005B11+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF005B11- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF024M24- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF011I12- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN025L17+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN031L21+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN040G17+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF003F15- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF001C19- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN017O17+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF014C07- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF015K10- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN006B19+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN041D08+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF004B10- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF029H09- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF031C17- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF018N02- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF018P08- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN040I23+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN011F02+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN013E07+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN032B07+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFN045B23+ TTCATCACTGTTACCAACCATATCTTCATC
JMFN012D18+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF004B10+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF011I12+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF003F15+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF031I13+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF024M24+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF008O09- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF001C19+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF031C17+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF018N02+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF018P08+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF008O09+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF015K10+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF014C07+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF029H09+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF031I13- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
JMFF028A20+ TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
rJMFF028A20- TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
                      ____________________________________________________________
consensus TTCATCACTGTTACCAACCATATCTTCATCACTGTCATATTCATCATTGTTACCAACCAT
 
. : . : . : . : . : . :
JMFF005B11+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF005B11- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF024M24- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF011I12- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN025L17+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN031L21+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN040G17+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF003F15- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF001C19- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN017O17+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF014C07- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF015K10- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN006B19+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN041D08+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF004B10- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF029H09- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF031C17- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF018N02- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF018P08- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN040I23+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN011F02+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN013E07+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN032B07+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFN012D18+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF004B10+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF011I12+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF003F15+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF031I13+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF024M24+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF008O09- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF001C19+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF031C17+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF018N02+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF018P08+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF008O09+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF015K10+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF014C07+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF029H09+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF031I13- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
JMFF028A20+ ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
rJMFF028A20- ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
                      ____________________________________________________________
consensus ATCTTCATCACTGCTCCCTTCATTTCTTCCTTTCATGTTTCCTTCCCCACCCTTTAGGGG
 
. : . : . : . : . : . :
JMFF005B11+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF005B11- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF024M24- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF011I12- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN025L17+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN031L21+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN040G17+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF003F15- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF001C19- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN017O17+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF014C07- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF015K10- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN006B19+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN041D08+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF004B10- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF029H09- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF031C17- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF018N02- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF018P08- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN040I23+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN011F02+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN013E07+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN032B07+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFN012D18+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF004B10+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF011I12+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF003F15+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF031I13+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF024M24+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF008O09- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF001C19+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF031C17+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF018N02+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF018P08+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF008O09+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF015K10+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF014C07+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF029H09+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF031I13- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
JMFF028A20+ GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
rJMFF028A20- GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
                      ____________________________________________________________
consensus GGAATGTAAAGGCTCATCACTTTTAGTATCAACAACTCCTTCACCCAAACTACTTGAAGG
 
. : . : . : . : . : . :
JMFF005B11+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF005B11- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF024M24- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF011I12- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN025L17+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN031L21+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN040G17+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF003F15- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF001C19- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN017O17+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF014C07- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAAGGCTGAGCTAAT
rJMFF015K10- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTANGGCTGAGCTAAT
JMFN006B19+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN041D08+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF004B10- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF029H09- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF031C17- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF018N02- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF018P08- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN040I23+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN011F02+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN013E07+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFN032B07+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGG
JMFN012D18+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF004B10+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF011I12+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF003F15+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF031I13+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF024M24+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF008O09- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF001C19+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF031C17+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF018N02+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF018P08+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF008O09+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF015K10+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF014C07+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF029H09+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF031I13- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
JMFF028A20+ ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
rJMFF028A20- ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
                      ____________________________________________________________
consensus ATGGAGATTGAAATGATGGGCATTTAATGTGGGAGGGGGTCGACTTAGGGCTGAGCTAAT
 
. : . : . : . : . : . :
JMFF005B11+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCA
rJMFF005B11- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACA
rJMFF024M24- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF011I12- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFN025L17+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFN031L21+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFN040G17+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF003F15- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF001C19- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACNTTTTGAAGATGC
JMFN017O17+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAA
rJMFF014C07- AAGGGATGATGAAATTACNANAAGCATGAAAGCCGCCATGCAAACACTTTTT
rJMFF015K10- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCG
JMFN006B19+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFN041D08+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF004B10- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF029H09- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF031C17- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF018N02- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF018P08- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFN040I23+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTT
JMFN011F02+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFN013E07+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAA-ACTTTTTGAAGATGC
JMFN012D18+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTT
JMFF004B10+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF011I12+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF003F15+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF031I13+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF024M24+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF008O09- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF001C19+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF031C17+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF018N02+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF018P08+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF008O09+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF015K10+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF014C07+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF029H09+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
rJMFF031I13- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
JMFF028A20+ AAGGGATGATGAAATTAGTAGAAGCATGAAAGCTGCCATGCAAACACTTTTTGAAGATGC
rJMFF028A20- AAGGGATGATGAAATTAGTAGAAGCATGAAAGCTGCCATGCAAACACTTTTTGAAGATGC
                      ____________________________________________________________
consensus AAGGGATGATGAAATTAGTAGAAGCATGAAAGCCGCCATGCAAACACTTTTTGAAGATGC
 
. : . : . : . : . : . :
rJMFF024M24- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGAT
rJMFF011I12- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATT
JMFN025L17+ CATAATGTTCAGTA
JMFN031L21+ CATAATGTTCAGTAGTACTCAGCTAG
JMFN040G17+ CATAATGTTCAGTAGTACTCA
rJMFF003F15- CATAATGTTCAGTAGTACTCAGCTAGCTAGTT
rJMFF001C19- C
JMFN006B19+ CATAATGTTCAG
JMFN041D08+ CATAATGTTCAGTAGTACTCA
rJMFF004B10- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGA
rJMFF029H09- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
rJMFF031C17- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
rJMFF018N02- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
rJMFF018P08- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFN013E07+ CAT
JMFF004B10+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGA
JMFF011I12+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATT
JMFF003F15+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTT
JMFF031I13+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGA
JMFF024M24+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGAT
rJMFF008O09- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF001C19+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF031C17+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF018N02+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF018P08+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF008O09+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF015K10+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF014C07+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
JMFF029H09+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGAC
rJMFF031I13- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGACGGTTCTCGACGA
JMFF028A20+ CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGAT
rJMFF028A20- CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGAT--CGGTTCTCGACGAAT
                      ____________________________________________________________
consensus CATAATGTTCAGTAGTACTCAGCTAGCTAGTTGAATTGAAGATGACGGTTCTCGACGAAT