Previous Contig 009533:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027P13Sequence564004548 (5)gb:AF224745_17785875e-53Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds759009533 (4)gb:AF224745_17785878e-55Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds
JMSF003F18Sequence407004548 (5)gb:AF224745_17785874e-26Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds794009533 (4)gb:AF224745_17785877e-78Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds
JMSF003M01Sequence355004548 (5)gb:AF224745_17785872e-13Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds761009533 (4)gb:AF224745_17785877e-65Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds
JMSF029F15Sequence721004548 (5)gb:AF224745_17785872e-70Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds727009533 (4)gb:AF224745_17785872e-66Arabidopsis thaliana Glu-tRNA(Gln) amidotransferase subunit A mRNA, complete cds

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003F18+ TTCAAATTT
                      ____________________________________________________________
consensus TTCAAATTT
 
. : . : . : . : . : . :
rJMSF003M01+ GGGAATCAAGTTGTTTGCAGATGAGCTTAATTCCC
rJMSF003F18+ ATCACGTTATGATTCTATCAGGTATGGGAATCAAGTTG-TTGCAGATGAGCTTAATTCCC
                      ____________________________________________________________
consensus ATCACGTTATGATTCTATCAGGTATGGGAATCAAGTTGTTTGCAGATGAGCTTAATTCCC
 
. : . : . : . : . : . :
rJMSF003M01+ TTTATGGGGGATCCCCGTGCTAAAGGCTTTGGTTCTGAGGTCAAAATGAGAATTCTAATG
rJMSF003F18+ TTTATGGGGGAT-CCCGTGCTAAAGGCTTTGGTTCTGAGGTCAAAATGAGAATTCTAATG
rJMSF029F15+ CCCGTGCTAAAGGCTTTGGTTCTGAGGTCAAAATGAGAATTCTAATG
                      ____________________________________________________________
consensus TTTATGGGGGATCCCCGTGCTAAAGGCTTTGGTTCTGAGGTCAAAATGAGAATTCTAATG
 
. : . : . : . : . : . :
rJMSF003M01+ GGAACATATGCCCTGTCAGCTGGTTATTATGATGCATACTACAAACGAGCTCAGCAGGTG
rJMSF003F18+ GGAACATATGCCCTGTCAGCTGGTTATTATGATGCATACTACAAACGAGCTCAGCAGGTG
rJMSF029F15+ GGAACATATGCCCTGTCAGCTGGTTATTATGATGCATACTACAAACGAGCTCAGCAGGTG
rJMFF027P13+ GGTTATTATGATGCATACTACAAACGAGCTCAGCAGGTG
                      ____________________________________________________________
consensus GGAACATATGCCCTGTCAGCTGGTTATTATGATGCATACTACAAACGAGCTCAGCAGGTG
 
. : . : . : . : . : . :
rJMSF003M01+ AGGGCCTTGGTAAGGGAAAGCTTTAGGGAAGCACTGGAAAATAATGATATCCTGATTTCA
rJMSF003F18+ AGGGCCTTGGTAAGGGAAAGCTTTAGGGAAGCACTGGAAAATAATGATATCCTGATTTCA
rJMSF029F15+ AGGGCCTTGGTAAGGGAAAGCTTTAGGGAAGCACTGGAAAATAATGATATCCTGATTTCA
rJMFF027P13+ AGGGCCTTGGTAAGGGAAAGCTTTAGGGAAGCACTGGAAAATAATGATATCCTGATTTCA
                      ____________________________________________________________
consensus AGGGCCTTGGTAAGGGAAAGCTTTAGGGAAGCACTGGAAAATAATGATATCCTGATTTCA
 
. : . : . : . : . : . :
rJMSF003M01+ CCAGCAGCGCCATCAGCAGCTTATAAAATTGGTGAGAAGAAGGATGATCCATTGGCAATG
rJMSF003F18+ CCAGCAGCGCCATCAGCAGCTTATAAAATTGGTGAGAAGAAGGATGATCCATTGGCAATG
rJMSF029F15+ CCAGCAGCGCCATCAGCAGCTTATAAAATTGGTGAGAAGAAGGATGATCCATTGGCAATG
rJMFF027P13+ CCAGCAGCGCCATCAGCAGCTTATAAAATTGGTGAGAAGAAGGATGATCCATTGGCAATG
                      ____________________________________________________________
consensus CCAGCAGCGCCATCAGCAGCTTATAAAATTGGTGAGAAGAAGGATGATCCATTGGCAATG
 
. : . : . : . : . : . :
rJMSF003M01+ TATGCAGGTGATATCATGACGGTGAATGTTAACCTGGCTGGTCTTCCTGCACTGGTTCTG
rJMSF003F18+ TATGCAGGTGATATCATGACGGTGAATGTTAACCTGGCTGGTCTTCCTGCACTGGTTCTG
rJMSF029F15+ TATGCAGGTGATATCATGACGGTGAATGTTAACCTGGCTGGTCTTCCTGCACTGGTTCTG
rJMFF027P13+ TATGCAGGTGATATCATGACGGTGAATGTTAACCTGGCTGGTCTTCCTGCACTGGTTCTG
                      ____________________________________________________________
consensus TATGCAGGTGATATCATGACGGTGAATGTTAACCTGGCTGGTCTTCCTGCACTGGTTCTG
 
. : . : . : . : . : . :
rJMSF003M01+ CCCTGTGGATTTGTTGACGGTGGTTCTGTATGGCTACCTGTTGGCGTTCAAATGATTGGC
rJMSF003F18+ CCCTGTGGATTTGTTGACGGTGGTTCTGTAGGGCTACCTGTTGGCGTTCAAATGATTGGC
rJMSF029F15+ CCCTGTGGATTTGTTGACGGTGGTTCTGTAGGGCTACCTGTTGGCGTTCAAATGATTGGC
rJMFF027P13+ CCCTGTGGATTTGTTGACGGTGGTTCTGTAGGGCTACCTGTTGGCGTTCAAATGATTGGC
                      ____________________________________________________________
consensus CCCTGTGGATTTGTTGACGGTGGTTCTGTAGGGCTACCTGTTGGCGTTCAAATGATTGGC
 
. : . : . : . : . : . :
rJMSF003M01+ GCTGCATTTGACGAGGGAAAACTTCTTAGAATGGGTCACATCTTCGAGCAAACACTTCAG
rJMSF003F18+ GCTGCATTTGACGAGGGAAAACTTCTTAGAATGGGTCACATCTTCGAGCAAACACTTCAG
rJMSF029F15+ GCTGCATTTGACGAGGGAAAACTTCTTAGAATGGGTCACATCTTCGAGCAAACACTTCAG
rJMFF027P13+ GCTGCATTTGACGAGGGAAAACTTCTTAGAATGGGTCACATCTTCGAGCAAACACTTCAG
                      ____________________________________________________________
consensus GCTGCATTTGACGAGGGAAAACTTCTTAGAATGGGTCACATCTTCGAGCAAACACTTCAG
 
. : . : . : . : . : . :
rJMSF003M01+ GGCTGCAGTTTTATTCCTCCCCTCGTGGCAGATGAATTTTCAAGCTAGTCACTAATTTTT
rJMSF003F18+ GGCTGCAGTTTTATTCCTCCCCTCGTGGCAGATGAATTTTCAAGCTAGTCACTAATTTTT
rJMSF029F15+ GGCTGCAGTTTTATTCCTCCCCTCGTGGCAGATGAATTTTCAAGCTAGTCACTAATTTTT
rJMFF027P13+ GGCTGCAGTTTTATTCCTCCCCTCGTGGCAGATGAATTTTCAAGCTAGTCACTAATTTTT
                      ____________________________________________________________
consensus GGCTGCAGTTTTATTCCTCCCCTCGTGGCAGATGAATTTTCAAGCTAGTCACTAATTTTT
 
. : . : . : . : . : . :
rJMSF003M01+ GCAGCTAACAACCATAATTATCCTAATGGAGATGAGGGAGAAATCTCCACCTGGGAAGCT
rJMSF003F18+ GCAGCTAACAACCATAATTATCCTAATGGAGATGAGGGAGAAATCTCCACCTGGGAAGCT
rJMSF029F15+ GCAGCTAACAACCATAATTATCCTAATGGAGATGAGGGAGAAATCTCCACCTGGGAAGCT
rJMFF027P13+ GCAGCTAACAACCATAATTATCCTAATGGAGATGAGGGAGAAATCTCCACCTGGGAAGCT
                      ____________________________________________________________
consensus GCAGCTAACAACCATAATTATCCTAATGGAGATGAGGGAGAAATCTCCACCTGGGAAGCT
 
. : . : . : . : . : . :
rJMSF003M01+ TTGTGCAGCAATGGCTTCAAGCTCTACCTTTTATAACACTATCATCTATCAAAGGGACAA
rJMSF003F18+ TTGTGCAGCAATGGCTTCAAGCTCTACCTTTTATAACACTATCATCTATCAAAGGGACAA
rJMSF029F15+ TTGTGCAGCAATGGCTTCAAGCTCTACCTTTTATAACACTATCATCTATCAAAGGGACAA
rJMFF027P13+ TTGTGCAGCAATGGCTTCAAGCTCTACCTTTTATAACACTATCATCTATCAAAGGGACAA
                      ____________________________________________________________
consensus TTGTGCAGCAATGGCTTCAAGCTCTACCTTTTATAACACTATCATCTATCAAAGGGACAA
 
. : . : . : . : . : . :
rJMSF003M01+ TGGCATCTGCGCGATACTAAACTGGATGGAACTAAGAATGGTAATGCGCCTGGTTTTATG
rJMSF003F18+ TGGCATCTGCGCGATACTAAACTGGATGGAACTAAGAATGGTAATGCGCCTGGTTTTATG
rJMSF029F15+ TGGCATCTGCGCGATACTAAACTGGATGGAACTAAGAATGGTAATGCGCCTGGTTTTATG
rJMFF027P13+ TGGCATCTGCGCGATACTAAACTGGATGGAACTAAGAATGGTAATGCGCCTGGTTTTATG
                      ____________________________________________________________
consensus TGGCATCTGCGCGATACTAAACTGGATGGAACTAAGAATGGTAATGCGCCTGGTTTTATG
 
. : . : . : . : . : . :
rJMSF003M01+ TATCTTCACATAGCTACATAAGTCTTGTGAATGTCCTTTCAAAGTGAGCATATTTGATTC
rJMSF003F18+ TATCTTCACATAGCTACATAAGTCTTGTGAATGTCCTTTCAAAGTGAGCATATTTGATTC
rJMSF029F15+ TATCTTCACATAGCTACATAAGTCTTGTGAATGTCCTTTCAAAGTGAGCATATTTGATTC
rJMFF027P13+ TATCTTCACATAGCTACATAAGTCTTGTGAATGTCCTTTCAAAGTGAGCATATTTGATTC
                      ____________________________________________________________
consensus TATCTTCACATAGCTACATAAGTCTTGTGAATGTCCTTTCAAAGTGAGCATATTTGATTC
 
. : . : . : . : . : . :
rJMSF003M01+ GAATAT
rJMSF003F18+ GAATAT
rJMSF029F15+ GAATATTGTGATACAAA
rJMFF027P13+ GAATATTGTGATACAAAATATTTAGCTTAAATTTAATGAACAACCATTCGAGAATGTGTA
                      ____________________________________________________________
consensus GAATATTGTGATACAAAATATTTAGCTTAAATTTAATGAACAACCATTCGAGAATGTGTA
 
. : . : . : . : . : . :
rJMFF027P13+ ATTTCACTAGATGGATGAGTTGGACTTATATTATATTTAAGTCAGGTTTTTAATACTTTA
                      ____________________________________________________________
consensus ATTTCACTAGATGGATGAGTTGGACTTATATTATATTTAAGTCAGGTTTTTAATACTTTA