Previous Contig 009528:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027O20Sequence598009528 (8)gb:AY088301_15733215e-45Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara688009528 (8)gb:AY088301_15733213e-50Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara
JMFN025A18Sequence639009528 (8)gb:AY088301_15733211e-45Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara
JMSF007B13Sequence670009528 (8)gb:AY088301_15733211e-50Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara
JMSF039P12Sequence685009528 (8)gb:AY088301_15733213e-48Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara810009528 (8)gb:AY088301_15733216e-51Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara
JMSF046I18Sequence775009528 (8)gb:AY088301_15733217e-51Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara798009528 (8)gb:AY088301_15733216e-51Arabidopsis thaliana clone 5367 mRNA, complete sequence.>gb:AY102132_1577737 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027O20- TTTGGAACGTCTGCA
JMSF039P12- TTTGGAACGTCTGCA
JMSF046I18- GATCCGAATTTGGAACGTCTGCA
rJMSF039P12+ GTCTGCA
                      ____________________________________________________________
consensus GATCCGAATTTGGAACGTCTGCA
 
. : . : . : . : . : . :
JMFF027O20- GGGTAGATTCTGAGAAAAGCA-TTGGGACTAACCCAACCATAGGG-TTTTAGCCCTTTGA
JMSF039P12- GGGTAGATTCTGAGAAAAGCA-TTGGGACTAACCCAACCATAGGG-TTTTAGCCCTTTGA
JMSF046I18- GGGTAGATTCTGAGAAAAGCA-TTGGGACTAACCCAACCATAGGG-TTTTAGCCCTTTGA
JMFN025A18- TTCTGAGAAAAGCA-TTGGGACTAACCCAACCATAGGG-TTTTAGCCCTTTGA
rJMSF039P12+ GGGTAGATTCTGAGAAAAGCA-TTGGGACTAACCCAACCATAGGG-TTTTAGCCCTTTGA
rJMSF046I18+ TGAGAAAAGCANTGGGGACTAACCCAACCATAGGGTTTTTAGCCCTTTGA
                      ____________________________________________________________
consensus GGGTAGATTCTGAGAAAAGCA-TTGGGACTAACCCAACCATAGGG-TTTTAGCCCTTTGA
 
. : . : . : . : . : . :
JMFF027O20- TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
JMSF039P12- TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
JMSF046I18- TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
rJMSF007B13+ ATC
JMFN025A18- TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
rJMSF039P12+ TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
rJMSF046I18+ TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
                      ____________________________________________________________
consensus TTCACAGAAATGGCGATGACACCGGCGAATTCTCCCAATTCCGGCTCCGACTCCGATATC
 
. : . : . : . : . : . :
JMFF027O20- GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
JMSF039P12- GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
JMSF046I18- GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
rJMSF007B13+ GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
JMFN025A18- GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
rJMSF039P12+ GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
rJMSF046I18+ GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
rJMFF027O20+ AAAGCCGACCCGAATGCCAACGTCACTCCC
                      ____________________________________________________________
consensus GACAACACTCCGACGCCGAGTTTGAACTCTAAAGCCGACCCGAATGCCAACGTCACTCCC
 
. : . : . : . : . : . :
JMFF027O20- GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
JMSF039P12- GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
JMSF046I18- GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
rJMSF007B13+ GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
JMFN025A18- GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
rJMSF039P12+ GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
rJMSF046I18+ GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
rJMFF027O20+ GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
                      ____________________________________________________________
consensus GACTCGTTGAGTCCCACCAATCCCTCTAGCCCGCCCGTCGTCTGCCTGTACAGGTTCGCC
 
. : . : . : . : . : . :
JMFF027O20- GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
JMSF039P12- GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
JMSF046I18- GCAGACTCCTTCGGTGGGGCTTTCATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
rJMSF007B13+ GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
JMFN025A18- GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
rJMSF039P12+ GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
rJMSF046I18+ GCAGACTCCTTCGGTGGGGCTTTCATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
rJMFF027O20+ GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
                      ____________________________________________________________
consensus GCAGACTCCTTCGGTGGGGCTTTTATGGGCTCCATTTTTGGATACGGTTCAGGATTGCTA
 
. : . : . : . : . : . :
JMFF027O20- AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
JMSF039P12- AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
JMSF046I18- AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
rJMSF007B13+ AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
JMFN025A18- AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
rJMSF039P12+ AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
rJMSF046I18+ AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
rJMFF027O20+ AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
                      ____________________________________________________________
consensus AGGAAGAAGGGACTTAAAGGATCTTTTGCAGAGGCAGGATCATCTGCAAAGACATTTGCA
 
. : . : . : . : . : . :
JMFF027O20- GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
JMSF039P12- GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
JMSF046I18- GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
rJMSF007B13+ GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
JMFN025A18- GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
rJMSF039P12+ GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
rJMSF046I18+ GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
rJMFF027O20+ GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
                      ____________________________________________________________
consensus GTATTATCGGGAGTTCACAGTGTGGTTGTTTGCTTTCTTAAGAGGCTGCGGGGAAAAGAT
 
. : . : . : . : . : . :
JMFF027O20- GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
JMSF039P12- GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
JMSF046I18- GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
rJMSF007B13+ GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
JMFN025A18- GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
rJMSF039P12+ GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
rJMSF046I18+ GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
rJMFF027O20+ GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
                      ____________________________________________________________
consensus GATGTAATTAATGCTGGAGTAGCTGGATGTTGCACTGGTCTTGCTCTAAGTTTTCCAGGT
 
. : . : . : . : . : . :
JMFF027O20- GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
JMSF039P12- GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
JMSF046I18- GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
rJMSF007B13+ GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
JMFN025A18- GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
rJMSF039P12+ GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
rJMSF046I18+ GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
rJMFF027O20+ GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
                      ____________________________________________________________
consensus GCACCTCAGGCTCTACTACAGAGCTGCCTCACTTTTGGTGCATTTTCCTTCGTTATCGAA
 
. : . : . : . : . : . :
JMFF027O20- GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCAT
JMSF039P12- GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
JMSF046I18- GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
rJMSF007B13+ GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
JMFN025A18- GGCCTTAACAAGCAGTAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
rJMSF039P12+ GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
rJMSF046I18+ GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
rJMFF027O20+ GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
                      ____________________________________________________________
consensus GGCCTTAACAAGCAGCAGCCTGCATTAGCACTGCCCGCTCCATTAGGTCTCAGAAGCAGC
 
. : . : . : . : . : . :
JMSF039P12- CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
JMSF046I18- CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
rJMSF007B13+ CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
JMFN025A18- CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTT
rJMSF039P12+ CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
rJMSF046I18+ CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
rJMFF027O20+ CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
                      ____________________________________________________________
consensus CAACACCCCGCCCTCCTTCCCCTATCATTCCCTCTACCAAACGAGCTTAAGGAGTCTTTC
 
. : . : . : . : . : . :
JMSF039P12- TCTTCCT
JMSF046I18- TCTTCCTTCTGCCACTCCCTTAAAAGACACGGGNAAGAACAATAATGCCCGTCGCTAGTT
rJMSF007B13+ TCTTCCTTCTGCCACTCCCTTAAAAGACACGGG-AAGAACAATAATGCCCGTCGCTAGTT
rJMSF039P12+ TCTTCCTTCTGCCACTCCCTTAAAAGACACGGG-AAGAACAATAATGCCCGTCGCTAGTT
rJMSF046I18+ TCTTCCTTCTGCCACTCCCTTAAAAGACACGGG-AAGAACAATAATGCCCGTCGCTAGTT
rJMFF027O20+ TCTTCCTTCTGCCACTCCCTTAAAAGACACGGG-AAGAACAATAATGCCCGTCGCTAGTT
                      ____________________________________________________________
consensus TCTTCCTTCTGCCACTCCCTTAAAAGACACGGG-AAGAACAATAATGCCCGTCGCTAGTT
 
. : . : . : . : . : . :
JMSF046I18- TANATTAATAGTTACTTCTT-ACGTTGAACGTTTA
rJMSF007B13+ TAGATTAATAGTTACTTCTTAACGTTGAACGTTTATTTGGAATCTCGAGATAAACTTGTA
rJMSF039P12+ TAGATTAATAGTTACTTCTT-ACGTTGAACGTTTATTTGGAATCTCGAGATAAACTTGTA
rJMSF046I18+ TAGATTAATAGTTACTTCTT-ACGTTGAACGTTTATTTGGAATCTCGAGATAAACTTGTA
rJMFF027O20+ TAGATTAATAGTTACTTCTT-ACGTTGAACGTTTATTTGGAATCTCGAGATAAACTTGTA
                      ____________________________________________________________
consensus TAGATTAATAGTTACTTCTT-ACGTTGAACGTTTATTTGGAATCTCGAGATAAACTTGTA
 
. : . : . : . : . : . :
rJMSF007B13+ AGGCTTTG
rJMSF039P12+ AGGCTTTGTGTATCTTAAACTTCTT
rJMSF046I18+ AGGCTTTGTGTATCTTAAACTTCTT
rJMFF027O20+ AGGCTTTGTGTATCTTAAACTTCTTTGCTGCTTTAGTGATTGATGATGGAATTTTCACAT
                      ____________________________________________________________
consensus AGGCTTTGTGTATCTTAAACTTCTTTGCTGCTTTAGTGATTGATGATGGAATTTTCACAT