Previous Contig 009524:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027N23Sequence532009524 (2)gb:AY085134_15702150.008Arabidopsis thaliana clone 13267 mRNA, complete sequence.705009524 (2)gb:AY085134_15702153e-62Arabidopsis thaliana clone 13267 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027N23- GACAGAGAGATGGAGCTGAGCCCACCTGGTTTGTACAGT
                      ____________________________________________________________
consensus GACAGAGAGATGGAGCTGAGCCCACCTGGTTTGTACAGT
 
. : . : . : . : . : . :
JMFF027N23- TTAGAGGAGTTGGTTGGAGCTCCAAGAAGAGAGAATTGGAGCACAACAACGCTCTTCACT
                      ____________________________________________________________
consensus TTAGAGGAGTTGGTTGGAGCTCCAAGAAGAGAGAATTGGAGCACAACAACGCTCTTCACT
 
. : . : . : . : . : . :
JMFF027N23- TCACCAGACACCTTCTTCTCAAACGCCTGGTCCAATGGCTTCGATGAATCCTTGGATCCT
                      ____________________________________________________________
consensus TCACCAGACACCTTCTTCTCAAACGCCTGGTCCAATGGCTTCGATGAATCCTTGGATCCT
 
. : . : . : . : . : . :
JMFF027N23- CCAGATTTTGTGTCCTCTTCTTCTTCTTCGCTACTCGACCTCCTCACTCTCCCCCAAGAA
                      ____________________________________________________________
consensus CCAGATTTTGTGTCCTCTTCTTCTTCTTCGCTACTCGACCTCCTCACTCTCCCCCAAGAA
 
. : . : . : . : . : . :
JMFF027N23- CCCACCACCTTTGCATGCCCAGACCTTCAGATCCAGCATGGCTGCGGCTTCGCTAATTGC
                      ____________________________________________________________
consensus CCCACCACCTTTGCATGCCCAGACCTTCAGATCCAGCATGGCTGCGGCTTCGCTAATTGC
 
. : . : . : . : . : . :
JMFF027N23- TGCGCCGCCGCCGCAGGAGGAGTACGGCGGCGGCGGCGGCGGAGGAGGAGTTTTCGGGGG
                      ____________________________________________________________
consensus TGCGCCGCCGCCGCAGGAGGAGTACGGCGGCGGCGGCGGCGGAGGAGGAGTTTTCGGGGG
 
. : . : . : . : . : . :
JMFF027N23- GATTAATAATCTGCAGGAGAGTGATGAGTTTAGTGGGTTGATGAGAAGCTGCGGTTGTGC
                      ____________________________________________________________
consensus GATTAATAATCTGCAGGAGAGTGATGAGTTTAGTGGGTTGATGAGAAGCTGCGGTTGTGC
 
. : . : . : . : . : . :
JMFF027N23- ACAAGTGAAGATGGGGCAGCTGGGTAACAATGGCGGCGGCGGCGGCGGCGGGGGGTTAAT
rJMFF027N23+ GCAGCTGGGTAACAATGGCGGCGGCGGCGGCGGCGGGGGGTTAAT
                      ____________________________________________________________
consensus ACAAGTGAAGATGGGGCAGCTGGGTAACAATGGCGGCGGCGGCGGCGGCGGGGGGTTAAT
 
. : . : . : . : . : . :
JMFF027N23- GGCCGGAGAAATAAAGAAGAGTAAATCCAAGAAAGTTGAAGGGCAGCCTTCCAAGAATCT
rJMFF027N23+ GNCCGGAGAAATAAAGAAGAGTAAATCCAAGAAAGTTGAAGGGCAGCCTTCCAAGAATCT
                      ____________________________________________________________
consensus GGCCGGAGAAATAAAGAAGAGTAAATCCAAGAAAGTTGAAGGGCAGCCTTCCAAGAATCT
 
. : . : . : . : . : . :
JMFF027N23- AATGGCGGAAAGG
rJMFF027N23+ AATGGCGGAAAGGCGGAGGAGGAAACGCCTTAACGACCGCCTCTCCATGCTCAGATCAAT
                      ____________________________________________________________
consensus AATGGCGGAAAGGCGGAGGAGGAAACGCCTTAACGACCGCCTCTCCATGCTCAGATCAAT
 
. : . : . : . : . : . :
rJMFF027N23+ CGTTCCCAAGATTAGCAAGATGGATAGAACCTCCATTCTTGGAGACACCATTGATTACAT
                      ____________________________________________________________
consensus CGTTCCCAAGATTAGCAAGATGGATAGAACCTCCATTCTTGGAGACACCATTGATTACAT
 
. : . : . : . : . : . :
rJMFF027N23+ GAAAGAGCTGTTAGAGAAAATCCATCAACTGCGTGAAGATACCTTGGAAGAAGACGACAA
                      ____________________________________________________________
consensus GAAAGAGCTGTTAGAGAAAATCCATCAACTGCGTGAAGATACCTTGGAAGAAGACGACAA
 
. : . : . : . : . : . :
rJMFF027N23+ AAACCACATCAAATCCCTCGCACCAAACACCAGCAGGGAACTCAAGTCTAATGAAGCAAT
                      ____________________________________________________________
consensus AAACCACATCAAATCCCTCGCACCAAACACCAGCAGGGAACTCAAGTCTAATGAAGCAAT
 
. : . : . : . : . : . :
rJMFF027N23+ TGTAAGAAATCCTCCAAAGTTTGATGTAGAAAGGAGAAACGTGGACACTAGAATCGAGAT
                      ____________________________________________________________
consensus TGTAAGAAATCCTCCAAAGTTTGATGTAGAAAGGAGAAACGTGGACACTAGAATCGAGAT
 
. : . : . : . : . : . :
rJMFF027N23+ ATGCTGCGCAACAAAACCTGGTTTGTTGTTGTCAACTGTGAGTACAATAGAAGCTCTGGG
                      ____________________________________________________________
consensus ATGCTGCGCAACAAAACCTGGTTTGTTGTTGTCAACTGTGAGTACAATAGAAGCTCTGGG
 
. : . : . : . : . : . :
rJMFF027N23+ TCTTGACATTCATCAATGCGTTATCAGCTGCTTCAATGACTTNTCCTTCCAAGCCACATG
                      ____________________________________________________________
consensus TCTTGACATTCATCAATGCGTTATCAGCTGCTTCAATGACTTNTCCTTCCAAGCCACATG
 
. : . : . : . : . : . :
rJMFF027N23+ CGCAGAGGCGACGGATCACAGAACGGTTCTGAGCCAGGAAGACGTAAAACAAGCGCTATT
                      ____________________________________________________________
consensus CGCAGAGGCGACGGATCACAGAACGGTTCTGAGCCAGGAAGACGTAAAACAAGCGCTATT
 
. : . : . : . : . : . :
rJMFF027N23+ CAAGACAGCCGGCTATGGAGGAAGGTGTCTGTAGGAATAGAATAATATTATTGTCTGGGG
                      ____________________________________________________________
consensus CAAGACAGCCGGCTATGGAGGAAGGTGTCTGTAGGAATAGAATAATATTATTGTCTGGGG
 
. : . : . : . : . : . :
rJMFF027N23+ AATAAATTTAGTAGTATTCCCACTTTTTAAGCGGACATACATGTCTCTTATTCACAACAA
                      ____________________________________________________________
consensus AATAAATTTAGTAGTATTCCCACTTTTTAAGCGGACATACATGTCTCTTATTCACAACAA