Previous Contig 009521:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027N06Sequence417009521 (2)gb:AJ864397_18149813e-05Cannabis sativa partial mRNA for ubiquitin-like protein SMT3 (smt3 gene).540009521 (2)gb:AB010071_15108972e-06Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCO15.>gb:AY075614_1567

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027N06- AACTAGTTTCACTGGAGACATCAATTTGGTATTACTCTTTCCATTTTCCACAACCTCCAC
rJMFF027N06+ AACTAGTTTCACTGGAGACATCAATTTGGTATTACTCTTTCCATTTTCCACAACCTCCAC
                      ____________________________________________________________
consensus AACTAGTTTCACTGGAGACATCAATTTGGTATTACTCTTTCCATTTTCCACAACCTCCAC
 
. : . : . : . : . : . :
JMFF027N06- CGGAGACATTGAAGGGCAGTAGATCGGTTTGCTGCTAACTTCTTCCATCTTCGACAAGAG
rJMFF027N06+ CGGAGACATTGAAGGGCAGTAGATCGGTTTGCTGCTAACTTCTTCCATCTTCGACAAGAG
                      ____________________________________________________________
consensus CGGAGACATTGAAGGGCAGTAGATCGGTTTGCTGCTAACTTCTTCCATCTTCGACAAGAG
 
. : . : . : . : . : . :
JMFF027N06- CCACCGGAGACGTTGAAGAGCTCGTGTTCAGTCTCGACGAACAAAAGGAAATGAGCGGAG
rJMFF027N06+ CCACCGGAGACGTTGAAGAGCTCGTGTTCAGTCTCGACGAACAAAAGGAAATGAGCGGAG
                      ____________________________________________________________
consensus CCACCGGAGACGTTGAAGAGCTCGTGTTCAGTCTCGACGAACAAAAGGAAATGAGCGGAG
 
. : . : . : . : . : . :
JMFF027N06- ACGATAGAATGATTGAGCTGTTCATCTTATTCCATCAGGATGGTATTCGCAGCAAAGTGA
rJMFF027N06+ ACGATAGAATGATTGAGCTGTTCATCTTATTCCATCAGGATGGTATTCGCAGCAAAGTGA
                      ____________________________________________________________
consensus ACGATAGAATGATTGAGCTGTTCATCTTATTCCATCAGGATGGTATTCGCAGCAAAGTGA
 
. : . : . : . : . : . :
JMFF027N06- GATGTAGGCGTGACAAAATGACGAAAATTTTATTGGTAGCTTATTGTGACAAAAAACAGT
rJMFF027N06+ GATGTAGGCGTGACAAAATGACGAAAATTTTATTGGTAGCTTATTGTGACAAAAAACAGT
                      ____________________________________________________________
consensus GATGTAGGCGTGACAAAATGACGAAAATTTTATTGGTAGCTTATTGTGACAAAAAACAGT
 
. : . : . : . : . : . :
JMFF027N06- TGGAGTATGGAGACATTCGGTTCCTGTATGAGGGGAAGCGCCTCCCCGTGAAGAAGACCC
rJMFF027N06+ TGGAGTATGGAGACATTCGGTTCCTGTATGAGGGGAAGCGCCTCCCCGTGAAGAAGACCC
                      ____________________________________________________________
consensus TGGAGTATGGAGACATTCGGTTCCTGTATGAGGGGAAGCGCCTCCCCGTGAAGAAGACCC
 
. : . : . : . : . : . :
JMFF027N06- CGAATGAGAGATGGGCATGAAAGATGGGGATGAGATCGAAGCATTTATGAATGTTCA
rJMFF027N06+ CGAATGAGAGATGGGCATGAAAGATGGGGATGAGATCGAAGCATTTATGAATGTTCAGGG
                      ____________________________________________________________
consensus CGAATGAGAGATGGGCATGAAAGATGGGGATGAGATCGAAGCATTTATGAATGTTCAGGG
 
. : . : . : . : . : . :
rJMFF027N06+ AGGAGGCCTGCTCGCCATTTGATGATTGGATTTCAACTTTCAATGCCTTTACTTGTTTTC
                      ____________________________________________________________
consensus AGGAGGCCTGCTCGCCATTTGATGATTGGATTTCAACTTTCAATGCCTTTACTTGTTTTC
 
. : . : . : . : . : . :
rJMFF027N06+ AGTTTTCAAAAGCATGTATGTGTTTGTCCATTTTTAATTATGCTATGTATTGCCAAAAAC
                      ____________________________________________________________
consensus AGTTTTCAAAAGCATGTATGTGTTTGTCCATTTTTAATTATGCTATGTATTGCCAAAAAC