Previous Contig 009510:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027K22Sequence583009510 (2)gb:AB022217_15150734e-38Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.>gb:BT010528_1640670009510 (2)gb:BT002983_16365664e-30Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027K22- AAGTGGCTACTTCCCTCC
                      ____________________________________________________________
consensus AAGTGGCTACTTCCCTCC
 
. : . : . : . : . : . :
JMFF027K22- GCTGCTTCACTTTCTGTTTTTTCTAATACAGCAATGGATCTAGACTTGAGTTTCTACGTC
                      ____________________________________________________________
consensus GCTGCTTCACTTTCTGTTTTTTCTAATACAGCAATGGATCTAGACTTGAGTTTCTACGTC
 
. : . : . : . : . : . :
JMFF027K22- GGAGTTGTAGGAAATATCCTCTCCATTTTCATCTTCCTTTCCCCCGCGGATGTATTCATT
                      ____________________________________________________________
consensus GGAGTTGTAGGAAATATCCTCTCCATTTTCATCTTCCTTTCCCCCGCGGATGTATTCATT
 
. : . : . : . : . : . :
JMFF027K22- AGGATAGTGAAGAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTG
rJMFF027K22+ CTCTACGTTG
                      ____________________________________________________________
consensus AGGATAGTGAAGAACAGATCCACAGAAGACTTCGATAGCATTCCTTACATCTCTACGTTG
 
. : . : . : . : . : . :
JMFF027K22- CTGAGTTCGTCCCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTC
rJMFF027K22+ CTGAGTTCGTCCCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTC
                      ____________________________________________________________
consensus CTGAGTTCGTCCCTTTGGTGCTACTATGGCCTTACAAAACCCGGTGCCTTTCTGGTTTTC
 
. : . : . : . : . : . :
JMFF027K22- ACTGTCAATGCTTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTC
rJMFF027K22+ ACTGTCAATGCTTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTC
                      ____________________________________________________________
consensus ACTGTCAATGCTTTCGGCGTTCTGGCCGAGACCGTATACGTCCTCATCTTCATCGTCTTC
 
. : . : . : . : . : . :
JMFF027K22- GCTCCTCCTAAAACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTT
rJMFF027K22+ GCTCCTCCTAAAACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTT
                      ____________________________________________________________
consensus GCTCCTCCTAAAACCAAGAAGAAGACGGCGGCTTTGGCCGCTGCTCTGAACATTGCTCTT
 
. : . : . : . : . : . :
JMFF027K22- CTGGCGGTTGTGATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCT
rJMFF027K22+ CTGGCGGTTGTGATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCT
                      ____________________________________________________________
consensus CTGGCGGTTGTGATTTTGGTGACCAAGTTCACACTTGAAGGAGAAGCTTTGATCGATGCT
 
. : . : . : . : . : . :
JMFF027K22- ATAGGTTATCTGTGCATTGTATTGAATATCATCATGGGACGGTATTGAGGACCAAGAGTG
rJMFF027K22+ ATAGGTTATCTGTGCATTGTATTGAATATCATCATGGGACGGTATTGAGGACCAAGAGTG
                      ____________________________________________________________
consensus ATAGGTTATCTGTGCATTGTATTGAATATCATCATGGGACGGTATTGAGGACCAAGAGTG
 
. : . : . : . : . : . :
JMFF027K22- TGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGGTGGCGTTTGGGCTG
rJMFF027K22+ TGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGGTGGCGTTTGGGCTG
                      ____________________________________________________________
consensus TGGAGTTCATGCCCTTCTACCTCTCACTTTTCATCTGCTTAAACGGTGGCGTTTGGGCTG
 
. : . : . : . : . : . :
JMFF027K22- TGTATGCTTTCATAGTTCGTGACTG
rJMFF027K22+ TGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGGGACAGGATTCATAT
                      ____________________________________________________________
consensus TGTATGCTTTCATAGTTCGTGACTGGTTTCTTGGGGTACCAAATGGGACAGGATTCATAT
 
. : . : . : . : . : . :
rJMFF027K22+ TTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAAAACAGCAAAATCCT
                      ____________________________________________________________
consensus TTGGGGCAGTACAGCTAATATTGTATGCCATTTACAGCAAGCCAAAAACAGCAAAATCCT
 
. : . : . : . : . : . :
rJMFF027K22+ CCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTCAGCTTAGATTTGTC
                      ____________________________________________________________
consensus CCACTGCAGTATTAGAAGACAGTATGCAAAATGAGCCCTTGATTTCAGCTTAGATTTGTC
 
. : . : . : . : . : . :
rJMFF027K22+ TTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATATATTTTCTCTTTAT
                      ____________________________________________________________
consensus TTTATTTTATTTTATTTTTATTTTTATTTCCAGGTTTTTTATTATATATTTTCTCTTTAT
 
. : . : . : . : . : . :
rJMFF027K22+ TTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAATTTTATTGTATGATAAAGAAGATAAT
                      ____________________________________________________________
consensus TTTTTGTTTTCTGTTTCTTAGCAACTTATTAAAATTTTATTGTATGATAAAGAAGATAAT