Previous Contig 009509:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027K17Sequence721009509 (5)gb:AP001539_18212801e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0708G02
JMFF029D16Sequence577009509 (5)gb:AP001539_18212808e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0708G02665011518 (6)pir|G96668|G966681e-40protein F1N19.7 [imported] - Arabidopsis thaliana>gb:AE005173_894104 Arabidopsis
JMFF035K17Sequence509011518 (6)pir|G96668|G966688e-38protein F1N19.7 [imported] - Arabidopsis thaliana>gb:AE005173_894104 Arabidopsis236009509 (5)
JMFF048H24Sequence427009509 (5)gb:AP001539_18212803e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0708G02395011518 (6)pir|G96668|G966687e-15protein F1N19.7 [imported] - Arabidopsis thaliana>gb:AE005173_894104 Arabidopsis
JMSF009J08Sequence267009509 (5)gb:AY063982_15659256e-09Arabidopsis thaliana putative peptide transporter protein (At1g64500) mRNA, comp758011518 (6)pir|G96668|G966683e-42protein F1N19.7 [imported] - Arabidopsis thaliana>gb:AE005173_894104 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF027K17+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
JMFF029D16+ CGGAGATTGGGATTTCTTTAACTCTACCTTCATGGACTCGGTTTTTGTCAGCCCCGCC
rJMFF027K17+ GCCGGAGATTGGGATTTCTTTAACTCTACCTTCATGGACTCGGTTTTTGTCAGCCCCGCC
                      ____________________________________________________________
consensus GCCGGAGATTGGGATTTCTTTAACTCTACCTTCATGGACTCGGTTTTTGTCAGCCCCGCC
 
. : . : . : . : . : . :
JMFF029D16+ GGTTTTGGCGTGAGTTTAGCGTCCAATTCTTCCACGGTATGAAACGAAGAGCTCTTTTTC
rJMFF027K17+ GGTTTTGGCGTGAGTTTAGCGTCCAATTCTTCCACGGTATGAAACGAAGAGCTCTTTTTC
                      ____________________________________________________________
consensus GGTTTTGGCGTGAGTTTAGCGTCCAATTCTTCCACGGTATGAAACGAAGAGCTCTTTTTC
 
. : . : . : . : . : . :
JMFF029D16+ GGCTTAGGCGGCGAGTGCTTTTTTTTCCGCCGCCGCTGGCGGCGGAGTAACGGCGTCTTT
JMFF048H24+ CTGGCGGCGGAGTAACGGCGTCTTT
rJMFF027K17+ GGCTTAGGCGGCGAGTGC-TTTTTTTCCGCCGCCGCTGGCGGCGGAGTAACGGCGTCTTT
                      ____________________________________________________________
consensus GGCTTAGGCGGCGAGTGCTTTTTTTTCCGCCGCCGCTGGCGGCGGAGTAACGGCGTCTTT
 
. : . : . : . : . : . :
JMFF029D16+ GGTGTTCTGAACCGCCGGCGGAAGCCCAGTGGAGTTTAACGTGGGCTTGAGGTCTTCCAA
JMFF048H24+ GGTGTTCTGAACCGCCGGCGGAAGCCCAGTGGAGTTTAACGTGGGCTTGAGGTCTTCCAA
rJMFF027K17+ GGTGTTCTGAACCGCCGGCGGAAGCCCAGTGGAGTTTAACGTGGGCTTGAGGTCTTCCAA
                      ____________________________________________________________
consensus GGTGTTCTGAACCGCCGGCGGAAGCCCAGTGGAGTTTAACGTGGGCTTGAGGTCTTCCAA
 
. : . : . : . : . : . :
JMSF009J08+ CAATGGAGTTGAGCTTCTCAAG
JMFF029D16+ GGCCTTGCTGACCTCATCCCAGGAGCGAGGAGCTTCTTCAATGGAGTTGAGCTTCTCAAG
JMFF048H24+ GGCCTTGCTGACCTCATCCCAGGAGCGAGGAGCTTCTTCAATGGAGTTGAGCTTCTCAAG
rJMFF027K17+ GGCCTTGCTGACCTCATCCCAGGAGCGAGGAGCTTCTTCAATGGAGTTGAGCTTCTCAAG
                      ____________________________________________________________
consensus GGCCTTGCTGACCTCATCCCAGGAGCGAGGAGCTTCTTCAATGGAGTTGAGCTTCTCAAG
 
. : . : . : . : . : . :
JMSF009J08+ CAACGGCGGCGGGACGTGCGCCACCGCCTTTATCTTCTCCGCCTCCTTCTTTTTCTCATC
JMFF029D16+ CAACGGCGGCGGGACGTGCGCCACCGCCTTTATCTTCTCCGCCTCCTTCTTTTTCTCATC
JMFF048H24+ CAACGGCGGCGGGACGTGCGCCACCGCCTTTATCTTCTCCGCCTCCTTCTTTTTCTCATC
rJMFF027K17+ CAACGGCGGCGGGACGTGCGCCACCGCCTTTATCTTCTCCGCCTCCTTCTTTTTCTCATC
                      ____________________________________________________________
consensus CAACGGCGGCGGGACGTGCGCCACCGCCTTTATCTTCTCCGCCTCCTTCTTTTTCTCATC
 
. : . : . : . : . : . :
JMSF009J08+ ATCATCATCGTCTTGCATGTCGCCGGCAGCCTTGCCATTCATCAGCCACGGCTCCTCCAC
JMFF029D16+ ATCATCATCGTCTTGCATGTCGCCGGCAGCCTTGCCATTCATCAGCCACGGCTCCTCCAC
JMFF048H24+ ATCATCATCGTCTTGCATGTCGCCGGCAGCCTTGCCATTCATCAGCCACGGCTCCTCCAC
rJMFF027K17+ ATCATCATCGTCTTGCATGTCGCCGGCAGCCTTGCCATTCATCAGCCACGGCTCCTCCAC
                      ____________________________________________________________
consensus ATCATCATCGTCTTGCATGTCGCCGGCAGCCTTGCCATTCATCAGCCACGGCTCCTCCAC
 
. : . : . : . : . : . :
JMSF009J08+ GTCGTTGACATCGAACACGGCGAAACTGGACGGCGGCGGACGGTACACGTCGACGGTGGC
JMFF029D16+ GTCGTTGACATCGAACACGGCGAAACTGGACGGCGGCGGACGGTACACGTCGACGGTGGC
JMFF048H24+ GTCGTTGACATCGAACACGGCGAAACTGGACGGCGGCGGACGGTACACGTCGACGGTGGC
rJMFF035K17+ GC
rJMFF027K17+ GTCGTTGACATCGAACACGGCGAAACTGGACGGCGGCGGACGGTACACGTCGACGGTGGC
                      ____________________________________________________________
consensus GTCGTTGACATCGAACACGGCGAAACTGGACGGCGGCGGACGGTACACGTCGACGGTGGC
 
. : . : . : . : . : . :
JMSF009J08+ CTTGATTCTCTTGGAAGAAGCGCACCCCATCTTGCCTTTTCTTGGTTTTCCGACGAGGCT
JMFF029D16+ CTTGATTCTCTTGGAAGAAGCGCACCCCATCTTGCCTTTTCTTGGTTTTCCGACGAGGCT
JMFF048H24+ CTTGATTCTCTTGGAAGAAGCGCACCCCATCTTGCCTTTTCTTGGTTTTCCGACGAGGCT
rJMFF035K17+ CTTGATTATCTTGGAAGAAGCGCACCCCATCTTGCCTTTTCNTGGTTTTCCGACGAGGCT
rJMFF027K17+ CTTGATTCTCTTGGAAGAAGCGCACCCCATCTTGCCTTTTCTTGGTTTTCCGACGAGGCT
                      ____________________________________________________________
consensus CTTGATTCTCTTGGAAGAAGCGCACCCCATCTTGCCTTTTCTTGGTTTTCCGACGAGGCT
 
. : . : . : . : . : . :
JMSF009J08+ TGTT
JMFF029D16+ TGTTAGTTAGTGTTTGAGTTTGGAGGATAGAGTAGATAT
JMFF048H24+ TGTTAGTTAGTGTTTGAGTTTGGAGGATAGAGTAGATAT
rJMFF035K17+ TGTTAGTTAGTGTTTGAGTTTGGAGGATAGAGTAGATATGTCGTTTTTGGTTAGAATAAT
rJMFF027K17+ TGTTAGTTAGTGTTTGAGTTTGGAGGATAGAGTAGATATGTCGTTTTTGGTTAGAATAAT
                      ____________________________________________________________
consensus TGTTAGTTAGTGTTTGAGTTTGGAGGATAGAGTAGATATGTCGTTTTTGGTTAGAATAAT
 
. : . : . : . : . : . :
rJMFF035K17+ TTGGTATTATTTGGGCGAAGAGAATTTGGCAAGATTGTAGTTGTATGGTTCTTGAAACGA
rJMFF027K17+ TTGGTATTATTTGGGCGAAGAGAATTTGGCAAGATTGTAGTTGTATGGTTCTTGAAACGA
                      ____________________________________________________________
consensus TTGGTATTATTTGGGCGAAGAGAATTTGGCAAGATTGTAGTTGTATGGTTCTTGAAACGA
 
. : . : . : . : . : . :
rJMFF035K17+ CGCGTGGCTCTTCATTTTTGGTCTGCATTCATTGATTGGTCATCGGAAAGGA
rJMFF027K17+ CGCGTGGCTCTTCATTTTTGGTCTGCATTCATTGATTGGTCATCGGAAAGGATAAACCAT
                      ____________________________________________________________
consensus CGCGTGGCTCTTCATTTTTGGTCTGCATTCATTGATTGGTCATCGGAAAGGATAAACCAT