Previous Contig 009508:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027K16Sequence431003062 (7)741009508 (13)
JMFS030E11Sequence280009508 (13)
JMFS042G11Sequence280009508 (13)
JMFS063F06Sequence587009508 (13)
JMFS064A05Sequence619009508 (13)
JMFS081B03Sequence627009508 (13)
JMFS081C03Sequence489009508 (13)
JMFS089H03Sequence553009508 (13)
JMFS103F03Sequence585009508 (13)
JMFS131B04Sequence603009508 (13)
JMSF026E13Sequence628003325 (37)gb:AP005631_18551073e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN750009508 (13)
JMSF027E13Sequence398009508 (13)
JMSF044O03Sequence739002983 (5)gb:AP005631_18551078e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN707009508 (13)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS064A05- TCACGCATGTTTTTAACTCCAGCCACTA
                      ____________________________________________________________
consensus TCACGCATGTTTTTAACTCCAGCCACTA
 
. : . : . : . : . : . :
JMFS064A05- CGATTGGGACGGTGGTCGCTGCTACTTGCAGCCGGAATGATAGACTAGCGTGGTTCACAC
                      ____________________________________________________________
consensus CGATTGGGACGGTGGTCGCTGCTACTTGCAGCCGGAATGATAGACTAGCGTGGTTCACAC
 
. : . : . : . : . : . :
JMFS064A05- GAAGACTTGATATAGAGGTGCAAACTACCGACCATGTGGGGATCGCCACGCTCGACATGT
JMFS081B03- GGATCGCCACGCTCGACATGT
                      ____________________________________________________________
consensus GAAGACTTGATATAGAGGTGCAAACTACCGACCATGTGGGGATCGCCACGCTCGACATGT
 
. : . : . : . : . : . :
JMFS064A05- ATATCTTCCCGATTATGCATAACAGCCGGTTCTTCATGATCAGCATCAGCTTCAAGCATG
rJMSF044O03+ TTCATGATCAGCATCAGTTTCAAGCATG
JMFS081C03- ATTCCCGATCATGCATAACAGCCGGTTTTTCAGGAACAGCACTATGTTTAAGCATG
JMFS081B03- ATATCTTCCCGATTATGCATAACAGCCGGTTCTTCATGATCAGCATCAGCTTCAAGCATG
                      ____________________________________________________________
consensus ATATCTTCCCGATTATGCATAACAGCCGGTTCTTCATGATCAGCATCAGCTTCAAGCATG
 
. : . : . : . : . : . :
JMFS064A05- GGACCTTTGACATTATTGACAGCGCTCCAGCTGTCAGCGATAGCATAGAGATATACGGAC
rJMSF044O03+ GGACCTTTGACATTATTGACAGCGCTCCAGCGGTCAGCGATAGCATAGAGATATACGGAC
JMFS081C03- GGACCTTAGACATTATAGACAGCGCTGCATCTGCCACCAATTGCCTAGAGATATACAGGC
JMFS081B03- GGACCTTTGACATTATTGACAGCGCTCCAGCTGTCAGCGATAGCATAGAGATATACGGAC
                      ____________________________________________________________
consensus GGACCTTTGACATTATTGACAGCGCTCCAGCTGTCAGCGATAGCATAGAGATATACGGAC
 
. : . : . : . : . : . :
JMFS064A05- GCATCCCGGGGGAATT--------GAGGGACCTCCTAGCTGCATATCTCGAGAGAAAACA
rJMSF044O03+ GCATCCCGGGGGAATTGCATTACAGAGGGACCTCCTAGCTGCATATCTCGAGAGAAAACA
JMFS042G11+ AGAAAACA
JMFS030E11+ AGAAAACA
JMFS081C03- GCATCCCGGGGGAATG--------AAGGGACCTACTAGCTGCATATATCTAGAGAAAACA
JMFS081B03- GCATCCCGGGGGAATT--------GAGGGACCTCCTAGCTGCATATCTCGAGAGAAAACA
rJMSF026E13+ GAGGGACCTCCTAGCTGCATATCTCGAGAGAAAACA
rJMFF027K16+ TAGCTGCATATCTCGAGAGAAAACA
                      ____________________________________________________________
consensus GCATCCCGGGGGAATT--------GAGGGACCTCCTAGCTGCATATCTCGAGAGAAAACA
 
. : . : . : . : . : . :
JMFS064A05- ACAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
rJMSF044O03+ ACAGCCGGTGCGTGCACTACGTCTGAGGGACATGCAACCTAAAAGGATGATGGTGGCATG
JMFS042G11+ ACAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
JMFS030E11+ ACAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
JMFS081C03- ACATCCAGGGCGTGCACTACGCTTGACGCATATGCAATCTACAATGATGATGGGCGCCTG
JMFS081B03- ACAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
rJMSF026E13+ ACAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
rJMFF027K16+ NCAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
                      ____________________________________________________________
consensus ACAGTCGGTGCGTGCACTACGTCTGAGGCATATGCAACCTAAAAGGATGATGGTGGCATG
 
. : . : . : . : . : . :
JMFS064A05- GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
rJMSF044O03+ GGGAGAACCCACGGCCGGTGTAGAGTCAGCGGTATATACGATGAGACACATGGAGGAATA
JMFS042G11+ GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
JMFS030E11+ GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
JMFS081C03- GGGAGAACCCACTGCCCGTGCAGACT-AGCCGGATATACCACGAGGCACATGGACACATA
JMFS081B03- GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
rJMSF026E13+ GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
JMFS103F03- CGGTATATACGATGAGGCACATGGAGTCATA
JMFS131B04+ AGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
JMFS089H03- GCACATGGAGTCATA
JMFS063F06- GTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
rJMFF027K16+ GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
                      ____________________________________________________________
consensus GGGAGAACCCACTGCCGGTGTAGAGTCAGCGGTATATACGATGAGGCACATGGAGTCATA
 
. : . : . : . : . : . :
JMFS064A05- TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
rJMSF044O03+ TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GT-GCGGCGCT
JMFS042G11+ TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
JMFS030E11+ TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
JMFS081C03- TGTTGGTCACAAATCCACCACCTTGTTGTCGCCGGCTACAAGCAGGGGTGCAGCGCCGCT
JMFS081B03- TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
rJMSF026E13+ TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
JMFS103F03- TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
JMFS131B04+ TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
JMFS089H03- TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
JMFS063F06- TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
rJMFF027K16+ TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
                      ____________________________________________________________
consensus TGTTGGTCAGAAATCCACCACC-TGGTATTGCGGGCTACAAGCAGGGG-GC-GCGCCGCT
 
. : . : . : . : . : . :
JMFS064A05- GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCANATGTCCA
rJMSF044O03+ GATGCTCAACCTTCGCAAGCGTTTCCTGCACAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS042G11+ GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS030E11+ GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS081C03- GATGCTCAACCTTCACAAGCGTTTACTGCATAACATCAT
JMFS081B03- GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
rJMSF026E13+ GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS103F03- GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS131B04+ GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS089H03- GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
rJMSF027E13+ TGCATAACATCATCCTCAGCGCCGCAAATGTCCA
JMFS063F06- GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
rJMFF027K16+ GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
                      ____________________________________________________________
consensus GATGCTCAACCTTCGCAAGCGTTTCCTGCATAACATCATCCTCAGCGCCGCAAATGTCCA
 
. : . : . : . : . : . :
JMFS064A05- CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
rJMSF044O03+ CGTGCAAAATATTATCGCACGTGTGGGGGAGTACGACCGCATGAGGGCTGCACAGATGCT
JMFS042G11+ CGTGCAAAATATTATCGCACGTGTG
JMFS030E11+ CGTGCAAAATATTATCGCACGTGTG
JMFS081B03- CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
rJMSF026E13+ CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
JMFS103F03- CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
JMFS131B04+ CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
JMFS089H03- CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
rJMSF027E13+ CGTGCAAAATATTATCGCACGNGTGGGAGAGTCCGATCGCGTGAGGGTTTCACAGATGCT
JMFS063F06- CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
rJMFF027K16+ CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
                      ____________________________________________________________
consensus CGTGCAAAATATTATCGCACGTGTGGGAGAGTACGATCGCGTGAGGGTTTCACAGATGCT
 
. : . : . : . : . : . :
JMFS064A05- TC
rJMSF044O03+ CCAATCAACGGCGCGCCAACCGTCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
JMFS081B03- TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
rJMSF026E13+ TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
JMFS103F03- TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
JMFS131B04+ TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
JMFS089H03- TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
rJMSF027E13+ TCAATCAACGACGCGCCAACCGNCCTAACANCNGCNTAGGGGGCAGCTCTGAAAAGCAAT
JMFS063F06- TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
rJMFF027K16+ TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
                      ____________________________________________________________
consensus TCAATCAACGACGCGCCAACCGGCCTAACAACTGCCTAGGGGGCAGCTCTGAAAAGCAAT
 
. : . : . : . : . : . :
rJMSF044O03+ AGTTAATAAACTGGGAC
JMFS081B03- AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
rJMSF026E13+ AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
JMFS103F03- AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
JMFS131B04+ AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
JMFS089H03- AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
rJMSF027E13+ AGTTAATAAACTGGGACCTTCAATCATTGTGNCCGNTTGCAGTAGTCGGTTAACTTATCC
JMFS063F06- AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
rJMFF027K16+ AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
                      ____________________________________________________________
consensus AGTTAATAAACTGGGACCTTCAATCATTGTGACCGATTGCAGTAGTCGGTTAACTTATCC
 
. : . : . : . : . : . :
JMFS081B03- TTTTTGCAAACATAATC
rJMSF026E13+ TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
JMFS103F03- TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
JMFS131B04+ TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
JMFS089H03- TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
rJMSF027E13+ TTTNAGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
JMFS063F06- TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
rJMFF027K16+ TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
                      ____________________________________________________________
consensus TTTTTGCAAACATAATCTGTGTAGGTGTGTAGTCTTGTTGTGCTAAATAGGGGTGCACCT
 
. : . : . : . : . : . :
rJMSF026E13+ CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
JMFS103F03- CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
JMFS131B04+ CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
JMFS089H03- CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
rJMSF027E13+ CCATTCAGCATATAATAAACANTGCATCNCTGGGCTCTTTTTGTTGGCGGTGCANCCCGT
JMFS063F06- CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
rJMFF027K16+ CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
                      ____________________________________________________________
consensus CCATTTAGCATATAATAAACAGTGCATCACTGGGCTCTTTTTGTTGGCGGTGCAGCCCGT
 
. : . : . : . : . : . :
rJMSF026E13+ TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
JMFS103F03- TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
JMFS131B04+ TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
JMFS089H03- TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
rJMSF027E13+ TGTTNCGGGNGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTNTACAGGCGGGA
JMFS063F06- TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
rJMFF027K16+ TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
                      ____________________________________________________________
consensus TGTTTCGGGTGGCGGTGCGATGCAGTTCGCTATTACTAAATCTATCCTCTACAGGCGGGA
 
. : . : . : . : . : . :
rJMSF026E13+ CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
JMFS103F03- CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
JMFS131B04+ CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
JMFS089H03- CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
JMFS063F06- CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
rJMFF027K16+ CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
                      ____________________________________________________________
consensus CATATACTCTCTTTCGTGTTTCTTGCTATGTTAAACGAATATGAGATGAATACTTAACAT
 
. : . : . : . : . : . :
rJMSF026E13+ TATATTTCTAGGTGCCAGTGGTGCATTACTATGTATACG
JMFS103F03- TATATTTCTAGGTG-C
JMFS131B04+ TATATTTCTAGGTG-CAGTGGTGCATTACT
JMFS089H03- T
JMFS063F06- TATATTTCT
rJMFF027K16+ TATATTTCTAGGTG-CAGTGGTGCATTACTATGTATACGTATCCTACCAATATANTAATA
                      ____________________________________________________________
consensus TATATTTCTAGGTG-CAGTGGTGCATTACTATGTATACGTATCCTACCAATATANTAATA