Previous Contig 009503:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002G05Sequence462009503 (8)gb:AB005246_15096032e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565735009503 (8)gb:AB005246_15096032e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565
JMFF006A07Sequence470009503 (8)gb:AB005246_15096033e-14Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565710009503 (8)gb:AB005246_15096032e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565
JMFF027H17Sequence544009503 (8)gb:AB005246_15096031e-12Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565751009503 (8)gb:AB005246_15096032e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565
JMSF011O13Sequence215009503 (8)778009503 (8)gb:AB005246_15096032e-29Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUP24.>gb:AY063871_1565

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF011O13- GGGTAGTTAGTATGGTAGGCTACAGATATAGGGGTTC
JMFF002G05- TAGTTAGTATGGTAGGCTACAGATATAGGGGTTC
JMFF006A07- TAGTTAGTATGGTAGGCTACAGATATAGGGGTTC
JMFF027H17- TAGTTAGTTTGGTAGGCTACAGATATAGGGGTTC
rJMSF011O13+ TAGTTAGTAT-GTAGGCTACAGATATAGGGGTTC
                      ____________________________________________________________
consensus GGGTAGTTAGTATGGTAGGCTACAGATATAGGGGTTC
 
. : . : . : . : . : . :
JMSF011O13- AGAGAGAGGGTTAGAGAATTCATTGTATCTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
JMFF002G05- AGAGAGAGGGTTAGAGAATTCATTGTATCTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
JMFF006A07- AGAGAGAGGGTTAGAGAATTCATTGTATCTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
JMFF027H17- AGAGAGAGGGTTAGAGAATTCATTGTATCTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
rJMSF011O13+ AGAGAGA-GGTTAGAGAATTCATTGTATCTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
rJMFF006A07+ TTCGTGTA
rJMFF002G05+ TCTGTAGGAAGAAGANCAGCGTTTATTCGTGTA
rJMFF027H17+ CTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
                      ____________________________________________________________
consensus AGAGAGAGGGTTAGAGAATTCATTGTATCTGTAGGAAGAAGAACAGCGTTTATTCGTGTA
 
. : . : . : . : . : . :
JMSF011O13- AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
JMFF002G05- AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
JMFF006A07- AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
JMFF027H17- AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
rJMSF011O13+ AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
rJMFF006A07+ AAAGTATATGATCTCAATCTCTATTTATCTCTGNTTATAAGAATCGATTGGCGTGTGATT
rJMFF002G05+ AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
rJMFF027H17+ AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
                      ____________________________________________________________
consensus AAAGTATATGATCTCAATCTCTATTTATCTCTGTTTATAAGAATCGATTGGCGTGTGATT
 
. : . : . : . : . : . :
JMSF011O13- CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGAC
JMFF002G05- CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
JMFF006A07- CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
JMFF027H17- CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
rJMSF011O13+ CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
rJMFF006A07+ CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
rJMFF002G05+ CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
rJMFF027H17+ CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
                      ____________________________________________________________
consensus CTGCAATGGCTGCATCGAGGAGCTATTTCCCGAGGAATAACTACCGGTTCCTGTCGACTG
 
. : . : . : . : . : . :
JMFF002G05- ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
JMFF006A07- ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
JMFF027H17- ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
rJMSF011O13+ ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
rJMFF006A07+ ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
rJMFF002G05+ ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
rJMFF027H17+ ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
                      ____________________________________________________________
consensus ACCGCGAGGCGCCGATCGGTGGCGACTCCGTGTTTGAATTTGAGGAGTCGGAGGTGTGGA
 
. : . : . : . : . : . :
JMFF002G05- ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
JMFF006A07- ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
JMFF027H17- ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
rJMSF011O13+ ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
rJMFF006A07+ ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
rJMFF002G05+ ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
rJMFF027H17+ ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
                      ____________________________________________________________
consensus ACGCGGCTCACTCCGCCTCTCCGGAGCGCCGGAAGGCGATTCCGAGTTCTCGCGCGAGGA
 
. : . : . : . : . : . :
JMFF002G05- AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
JMFF006A07- AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGCGGGCGCCGGGGTCCCTGCCGGTG
JMFF027H17- AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
rJMSF011O13+ AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
rJMFF006A07+ AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
rJMFF002G05+ AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
rJMFF027H17+ AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
                      ____________________________________________________________
consensus AACCGTCGGCCGTGAGCGGCACGCGCGTGGTCGGAGC-GGCGCCGGGGTCCCTGCCGGTG
 
. : . : . : . : . : . :
JMFF002G05- AACGTGCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGNCGGAGGGAC
JMFF006A07- AACGTGCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGGAGGGAC
JMFF027H17- AACGTTCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGTAGGGAC
rJMSF011O13+ AACGTGCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGGAGGGAC
rJMFF006A07+ AACGTGCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGGAGGGAC
rJMFF002G05+ AACGTGCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGGAGGGAC
rJMFF027H17+ AACGTTCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGTAGGGAC
                      ____________________________________________________________
consensus AACGTGCCGGACTGGTCGAAGATACTGAAGGACGAGTACAGGGAGAACCGGCGGAGGGAC
 
. : . : . : . : . : . :
JMFF002G05- TGCGACGA
JMFF006A07- TGCNACGATGATTTC
JMFF027H17- TGCGACGATGATTTCGACGACGAGGAGGAGGACGGCGGCGGCGACGGTGGCGATCGGGTC
rJMSF011O13+ TGCGACGATGATTTCGACGACGAGGAGGAGGACGGCGGCGGCGACGGTGGCGATCGGGTC
rJMFF006A07+ TGCGACGATGATTTCGACGACGAGGAGGAGGACGGCGGCGGCGACGGTGGCGATCGGGTC
rJMFF002G05+ TGCGACGATGATTTCGACGACGAGGAGGAGGACGGCGGCGGCGACGGTGGCGATCGGGTC
rJMFF027H17+ TGCGACGATGATTTCGACGACGAGGAGGAGGACGGCGGCGGCGACGGTGGCGATCGGGTC
                      ____________________________________________________________
consensus TGCGACGATGATTTCGACGACGAGGAGGAGGACGGCGGCGGCGACGGTGGCGATCGGGTC
 
. : . : . : . : . : . :
JMFF027H17- CCGCCGCACGAGTTCGTGGCGCAGCAGTTG
rJMSF011O13+ CCGCCGCACGAGTTCGTGGCGCAGCAGTTGGCGAGGACTCGAATCGCCTCCTTCTCGGTG
rJMFF006A07+ CCGCCGCACGAGTTCGTGGCGCAGCAGTTGGCGAGGACTCGAATCGCCTCCTTCTCGGTG
rJMFF002G05+ CCGCCGCACGAGTTCGTGGCGCAGCAGTTGGCGAGGACTCGAATCGCCTCCTTCTCGGTG
rJMFF027H17+ CCGCCGCACGAGTTCGTGGCGCAGCAGTTGGCGAGGACTCGAATCGCCTCCTTCTCGGTG
                      ____________________________________________________________
consensus CCGCCGCACGAGTTCGTGGCGCAGCAGTTGGCGAGGACTCGAATCGCCTCCTTCTCGGTG
 
. : . : . : . : . : . :
rJMSF011O13+ CACGAGGGCATCGGGCGCACCCTCAAAGGCAGAGACCTGAGTAGAGTCCGCAACGCGATT
rJMFF006A07+ CACGAGGGCATCGGGCGCACCCTCAAAGGCAGAGACCTGAGTAGAGTCCGCAACGCGATT
rJMFF002G05+ CACGAGGGCATCGGGCGCACCCTCAAAGGCAGAGACCTGAGTAGAGTCCGCAACGCGATT
rJMFF027H17+ CACGAGGGCATCGGGCGCACCCTCAAAGGCAGAGACCTGAGTAGAGTCCGCAACGCGATT
                      ____________________________________________________________
consensus CACGAGGGCATCGGGCGCACCCTCAAAGGCAGAGACCTGAGTAGAGTCCGCAACGCGATT
 
. : . : . : . : . : . :
rJMSF011O13+ TGGAAGAAAACCGGTTTCGAAGACTAACCTAACTGGAGGCGAGGATTGATTTTCCTTTTT
rJMFF006A07+ TGGAAGAAAACCGGTTTCGAAGACTAACCTAACTGGAGGCGAGGATTGATTTTCCTTTTT
rJMFF002G05+ TGGAAGAAAACCGGTTTCGAAGACTAACCTAACTGGAGGCGAGGATTGATTTTCCTTTTT
rJMFF027H17+ TGGAAGAAAACCGGTTTCGAAGACTAACCTAACTGGAGGCGAGGATTGATTTTCCTTTTT
                      ____________________________________________________________
consensus TGGAAGAAAACCGGTTTCGAAGACTAACCTAACTGGAGGCGAGGATTGATTTTCCTTTTT
 
. : . : . : . : . : . :
rJMSF011O13+ CGTTTTCAAATTTTCCGCTTCCATATTTCCGGATTTTGATTTTTATTTATTTCTCGGAAG
rJMFF006A07+ CGTTTTCAAATTTTCCGCTTCCATATTTCCGGATTTTGATTTTTATTTATTTCTCGGAAG
rJMFF002G05+ CGTTTTCAAATTTTCCGCTTCCATATTTCCGGATTTTGATTTTTATTTATTTCTCGGAAG
rJMFF027H17+ CGTTTTCAAATTTTCCGCTTCCATATTTCCGGATTTTGATTTTTATTTATTTCTCGGAAG
                      ____________________________________________________________
consensus CGTTTTCAAATTTTCCGCTTCCATATTTCCGGATTTTGATTTTTATTTATTTCTCGGAAG
 
. : . : . : . : . : . :
rJMSF011O13+ TGAACTGCCTA
rJMFF006A07+ TGAACTGCCTAGCGGAAACGGATTACACGCATGTAATCGTAAC
rJMFF002G05+ TGAACTGCCTAGCGGAAACGGATTACACGCATGTAATCGTAAC
rJMFF027H17+ TGAACTGCCTAGCGGAAACGGATTACACGCATGTAATCGTAACGTTAAGGAGATAAAAAT
                      ____________________________________________________________
consensus TGAACTGCCTAGCGGAAACGGATTACACGCATGTAATCGTAACGTTAAGGAGATAAAAAT