Previous Contig 009501:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007H24Sequence492001124 (7)pir|T02604|T026043e-59probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705736009501 (7)pir|T02604|T026048e-47probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMFF022N10Sequence446001124 (7)pir|F84706|F847065e-13probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC002338742009501 (7)pir|T02604|T026045e-48probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMFF027H08Sequence576008012 (2)pir|T02602|T02602e-100vacuolar sorting receptor protein homolog At2g14740 - Arabidopsis thaliana>gb:AC747009501 (7)pir|T02604|T026042e-47probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMFF028I24Sequence478001124 (7)pir|T02604|T026041e-60probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705572009501 (7)pir|T02604|T026045e-20probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMSF028N24Sequence712001124 (7)pir|T02604|T026048e-86probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705638009501 (7)pir|T02604|T026044e-29probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMSF045H24Sequence689001124 (7)pir|T02604|T026047e-62probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705735009501 (7)pir|T02604|T026042e-42probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705
JMSF046J16Sequence726001124 (7)pir|T02604|T026044e-66probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705704009501 (7)pir|T02604|T026043e-41probable vacuolar sorting receptor [imported] - Arabidopsis thaliana>gb:AC004705

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF007H24+ GAAGATGGCAAGTGCACATGTCC
rJMSF045H24+ GAAGATGGCAAGTGCACATGTCC
rJMFF022N10+ GTGGACGAGGAAGATGGCAAGTGCACATGTCC
rJMFF027H08+ GAAGATGGCAAGTGCACATGTCC
                      ____________________________________________________________
consensus GTGGACGAGGAAGATGGCAAGTGCACATGTCC
 
. : . : . : . : . : . :
rJMFF007H24+ TCCAGGATTT-AAAGGAGACGGCAAAAGTTGTCAAGATATTGATGAATGCAAGGAAAAGA
rJMSF045H24+ TCCAGGATTTAAAAGGAGACGGCAAAAGTTGTCAAGATATTGATGAATGCAAGGAAAAGA
rJMFF022N10+ TCCAGGATTT-AAAGGAGACGGCAAAAGTTGTCAAGATATTGATGAATGCAAGGAAAAGA
rJMSF046J16+ TT-AAAGGAGACGGCAAAAGTTGTCAAGATATTGATGAATGCAAGGAAAAGA
rJMFF027H08+ TCCAGGATTT-AAAGGAGACGGCAAAAGTTGTCAAGATATTGATGAATGCAAGGAAAAGA
                      ____________________________________________________________
consensus TCCAGGATTT-AAAGGAGACGGCAAAAGTTGTCAAGATATTGATGAATGCAAGGAAAAGA
 
. : . : . : . : . : . :
rJMFF007H24+ AAGCCTGCCAGTGCCCTGAATGCAGCTGCACAAATACNTGGGGTAGCTACGAATGCACTT
rJMSF045H24+ AAGCCTGCCAGTGCCCTGAATGCAGCTGCACAAATACCTGGGGTAGCTACGAATGCACTT
rJMFF028I24+ ACGAATGCACTT
rJMFF022N10+ AAGCCTGCCAGTGCCCTGAATGCAGCTGCACAAATACCTGGGGTAGCTACGAATGCACTT
rJMSF046J16+ AAGCCTGCCAGTGCCCTGAATGCAGCTGCACAAATACCTGGGGTAGCTACGAATGCACTT
rJMSF028N24+ CTGAATGCAGCTGCACAAATACCTGGGGTAGCTACGAATGCACTT
rJMFF027H08+ AAGCCTGCCAGTGCCCTGAATGCAGCTGCACAAATACCTGGGGTAGCTACGAATGCACTT
                      ____________________________________________________________
consensus AAGCCTGCCAGTGCCCTGAATGCAGCTGCACAAATACCTGGGGTAGCTACGAATGCACTT
 
. : . : . : . : . : . :
rJMFF007H24+ GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
rJMSF045H24+ GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
rJMFF028I24+ GTAGCAGTGACTTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
rJMFF022N10+ GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
rJMSF046J16+ GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
rJMSF028N24+ GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
rJMFF027H08+ GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
                      ____________________________________________________________
consensus GTAGCAGTGACCTACTGTACATGAGAGACCACGATACTTGCATTAGTAAGAAGGCTGCGA
 
. : . : . : . : . : . :
rJMFF007H24+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
rJMSF045H24+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
rJMFF028I24+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
rJMFF022N10+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
rJMSF046J16+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
rJMSF028N24+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
rJMFF027H08+ CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
                      ____________________________________________________________
consensus CTGAAGTCAAGTCTGCATGGACTGCTGTATTGGTCATTATTATAGGACTCGCCATGGCTG
 
. : . : . : . : . : . :
rJMFF007H24+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
rJMSF045H24+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
rJMFF028I24+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
rJMFF022N10+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
rJMSF046J16+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
rJMSF028N24+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
rJMFF027H08+ CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
                      ____________________________________________________________
consensus CTGGTGGGGCATATCTTGTATACAAATATAGATTTAGGTCATACATGGACACTGAGATCA
 
. : . : . : . : . : . :
rJMFF007H24+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
rJMSF045H24+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
rJMFF028I24+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
rJMFF022N10+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
rJMSF046J16+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
rJMSF028N24+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
rJMFF027H08+ GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
                      ____________________________________________________________
consensus GGGCCATAATGGCGCAATACATGCCACTCGACAGCCAAAATGAAGTTCCATACCATGTTT
 
. : . : . : . : . : . :
rJMFF007H24+ CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
rJMSF045H24+ CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
rJMFF028I24+ NTGATGACCGTACNTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
rJMFF022N10+ CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
rJMSF046J16+ CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
rJMSF028N24+ CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
rJMFF027H08+ CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
                      ____________________________________________________________
consensus CTGATGACCGTACCTGAAGGATGGATACTTGTCGCTATGCATCCAAGAATGAAGTTCCCG
 
. : . : . : . : . : . :
rJMFF007H24+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
rJMSF045H24+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
rJMFF028I24+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
rJMFF022N10+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
rJMSF046J16+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
rJMSF028N24+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
rJMFF027H08+ GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
                      ____________________________________________________________
consensus GAACTTTGTAAAAACTGTGCAGGAGAAAGGGAAGCCTCTAATCATTACCATTCTTTCAGA
 
. : . : . : . : . : . :
rJMFF007H24+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
rJMSF045H24+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
rJMFF028I24+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
rJMFF022N10+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
rJMSF046J16+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
rJMSF028N24+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
rJMFF027H08+ ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
                      ____________________________________________________________
consensus ATCATTGCACAGGGATCAAATGCCTCTTTTCCTATCAAGGGTTGGTAAAATTATTTGGGA
 
. : . : . : . : . : . :
rJMFF007H24+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
rJMSF045H24+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
rJMFF028I24+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
rJMFF022N10+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
rJMSF046J16+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
rJMSF028N24+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
rJMFF027H08+ GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
                      ____________________________________________________________
consensus GAGTTGTAAATTATGTCAGACAATAAACTTATAAACATCTTGTTTGGTGTCTTGTAACGT
 
. : . : . : . : . : . :
rJMFF007H24+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
rJMSF045H24+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
rJMFF028I24+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
rJMFF022N10+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
rJMSF046J16+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
rJMSF028N24+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
rJMFF027H08+ TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
                      ____________________________________________________________
consensus TGTGAGCTAGGAATTAGCTAAGGTGCACCAGGGAATGTGGGGTTATGTAGATCCCCTCTA
 
. : . : . : . : . : . :
rJMFF007H24+ TGGTGGATGCTTNTAACGAGTGCAATTGTTTTTCTTATGC-AACAGGAAAT
rJMSF045H24+ TGGTGGATGCTTTTAACGAGTGCAATTGTTTTTCTTATGCAAACAGGAAATC
rJMFF028I24+ TGGTGGATGCTTTTAACGAG
rJMFF022N10+ TGGTGGATGCTTTTAACGAGTGCAATTGTTTTTCTTATGC-AACAGGAAATC
rJMSF046J16+ TGGTGGATGCTTTTAACGAGTGCAATTGTTTTTCTTATGC-AACAGGAAATCAG
rJMSF028N24+ TGGTGGATGCTTTTAACGAGTGCAATTGTTTTTCTTATGC-AACAGGAAATCAG
rJMFF027H08+ TGGTGGATGCTTTTAACGAGTGCAATTGTTTTTCTTATGC-AACAGGAAATCAGTACATT
                      ____________________________________________________________
consensus TGGTGGATGCTTTTAACGAGTGCAATTGTTTTTCTTATGC-AACAGGAAATCAGTACATT