Previous Contig 009498:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027F10Sequence168014611404009498 (3)gb:AJ697695_18133740.011Nicotiana benthamiana mRNA for ALY protein (ALY615 allele).
JMSF017F03Sequence235009498 (3)gb:AJ697696_18133753e-25Nicotiana benthamiana mRNA for ALY protein (ALY617 allele).768009498 (3)gb:AJ697696_18133754e-51Nicotiana benthamiana mRNA for ALY protein (ALY617 allele).

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017F03- GAGTCATGACATGTTTTCGGTGGATCAGCAGATGGCGTTTCCCGGCCAAGTAGGC
rJMSF017F03+ GAGTCATGACATGTTTTCGGTGGATCAGCAGATGGCGTTTCCCGGCCAAGTAGGC
                      ____________________________________________________________
consensus GAGTCATGACATGTTTTCGGTGGATCAGCAGATGGCGTTTCCCGGCCAAGTAGGC
 
. : . : . : . : . : . :
JMSF017F03- GGTGGCGGTCGACCTTCTTCCATAGAGACTGGCACCAAGCTCTATATATCCAACCTAGAG
rJMSF017F03+ GGTGGCGGTCGACCTTCTTCCATAGAGACTGGCACCAAGCTCTATATATCCAACCTAGAG
                      ____________________________________________________________
consensus GGTGGCGGTCGACCTTCTTCCATAGAGACTGGCACCAAGCTCTATATATCCAACCTAGAG
 
. : . : . : . : . : . :
JMSF017F03- TATAGCGTCTCTAACGAGGATGTCAAGGAACTCTTCTCAGAGGTTGGTGATCTGAAATCC
rJMSF017F03+ TATAGCGTCTCTAACGAGGATGTCAAGGAACTCTTCTCAGAGGTTGGTGATCTGAAATCC
                      ____________________________________________________________
consensus TATAGCGTCTCTAACGAGGATGTCAAGGAACTCTTCTCAGAGGTTGGTGATCTGAAATCC
 
. : . : . : . : . : . :
JMSF017F03- TTTGCAATTCATTATGATAGGAGTGGAAGATCAAAGGGAACAGCAGAAGTTGTCTTCTCA
rJMSF017F03+ TTTGCAATTCATTATGATAGGAGTGGAAGATCAAAGGGAACAGCAGAAGTTGTCTTCTCA
                      ____________________________________________________________
consensus TTTGCAATTCATTATGATAGGAGTGGAAGATCAAAGGGAACAGCAGAAGTTGTCTTCTCA
 
. : . : . : . : . : . :
rJMSF017F03+ CGTCGACAAGATGCTTTAGCAGCTGTGAAAAGGTATAACAATGTTCAACTCGATGGCAAG
                      ____________________________________________________________
consensus CGTCGACAAGATGCTTTAGCAGCTGTGAAAAGGTATAACAATGTTCAACTCGATGGCAAG
 
. : . : . : . : . : . :
rJMSF017F03+ GCAATGCATATAGAGATTGTAGGCACAAACATTGCAGCCCCTCCTGCTCCATCTTCCTAC
                      ____________________________________________________________
consensus GCAATGCATATAGAGATTGTAGGCACAAACATTGCAGCCCCTCCTGCTCCATCTTCCTAC
 
. : . : . : . : . : . :
rJMSF017F03+ AGTGGTGGTGCCTATGGAGATTTCAATGGAATTCCTAGAAGTGGGCAAGGGCGAGGTGGA
rJMFF027F10+ GATTTCNATGGAATTCTTAGAAGTGNGCAAGNNCGAGNNGGA
                      ____________________________________________________________
consensus AGTGGTGGTGCCTATGGAGATTTCAATGGAATTCTTAGAAGTGGGCAAGGGCGAGGTGGA
 
. : . : . : . : . : . :
rJMSF017F03+ GGTGGAGGTGGAGTATTCGGAAGGCCACGTGGTGGCAATAGGGGAAGAGGCCGTGGTTTC
rJMFF027F10+ GGTGGAGNTGGAGTATTCGGAAGNCCACGTGGTGGCAATAGGGGAAGAGNCCGTGGTTTC
                      ____________________________________________________________
consensus GGTGGAGGTGGAGTATTCGGAAGGCCACGTGGTGGCAATAGGGGAAGAGGCCGTGGTTTC
 
. : . : . : . : . : . :
rJMSF017F03+ CGAGGAGGAGGAAGAGGAGGTGGAGGAGGTCGAGGACAAGGTAGAGGGCGTGGAGAGAAA
rJMFF027F10+ CGAGGAGGAGGAAGAGGAGGTGGAGGAGGTCGAGGACAAGGTAGAGGGCGTGGAGAGAAA
                      ____________________________________________________________
consensus CGAGGAGGAGGAAGAGGAGGTGGAGGAGGTCGAGGACAAGGTAGAGGGCGTGGAGAGAAA
 
. : . : . : . : . : . :
rJMSF017F03+ GTAGTATCTGCAGAAGATCTTGATGCTGACTTGGAGAAGTACCACTCGGAAGCAATGCAA
rJMFF027F10+ GTAGTATCTGCAGAAGATCTTGATGCTGACTTGGAGAAGTACCACTCGGAAGCAATGCAA
                      ____________________________________________________________
consensus GTAGTATCTGCAGAAGATCTTGATGCTGACTTGGAGAAGTACCACTCGGAAGCAATGCAA
 
. : . : . : . : . : . :
rJMSF017F03+ GAAAATTAATGAATTCCTCCTCTATCATTGTTTTGTTTTGTCTACACTTGCTGTAACTAT
rJMFF027F10+ GAAAATTAATGAATTCCTCCTCTATCANTGTTTTGTTTCGTCTACACTTGCTGTAACTAT
                      ____________________________________________________________
consensus GAAAATTAATGAATTCCTCCTCTATCATTGTTTTGTTTTGTCTACACTTGCTGTAACTAT
 
. : . : . : . : . : . :
rJMSF017F03+ TCTGCGAATTTATGCTTTGCTTGATGATTACACAGACAACTCTCTTGTATGTTTAGCCTC
rJMFF027F10+ TNTGCGAATTTATGCTTTGCTTGATGATTACACAGACAACTCTCTNGTATGTTTAGCCNC
                      ____________________________________________________________
consensus TCTGCGAATTTATGCTTTGCTTGATGATTACACAGACAACTCTCTTGTATGTTTAGCCTC
 
. : . : . : . : . : . :
rJMSF017F03+ CTAGAATTACCATGGAAGTAATGAGTTTGTAACACATTTCTTACT
rJMFF027F10+ CTAGAATTA-CATGGAAGTAATGAGTNNGTAACACATTTCNTACTNACTCCGTTTAAATC
                      ____________________________________________________________
consensus CTAGAATTACCATGGAAGTAATGAGTTTGTAACACATTTCTTACTNACTCCGTTTAAATC