Previous Contig 009496:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027E19Sequence351009496 (2)gb:AY136377_15818781e-04Arabidopsis thaliana unknown protein mRNA, complete cds.>gb:BT000192_1634470 Ara
JMFN018D03Sequence462009496 (2)gb:AY136377_15818789e-05Arabidopsis thaliana unknown protein mRNA, complete cds.>gb:BT000192_1634470 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN018D03+ AATAAGGAATATAAGTATA
                      ____________________________________________________________
consensus AATAAGGAATATAAGTATA
 
. : . : . : . : . : . :
JMFN018D03+ TTTAAATATAATAAGTATGATTATCACAAATTCATAATACTAGCTCATATATTACTGAGC
                      ____________________________________________________________
consensus TTTAAATATAATAAGTATGATTATCACAAATTCATAATACTAGCTCATATATTACTGAGC
 
. : . : . : . : . : . :
JMFN018D03+ GATGCCAATTCAAGAAACACCATAGGAAATACTTGTATATAAGTATGTATGAGCGTATAT
                      ____________________________________________________________
consensus GATGCCAATTCAAGAAACACCATAGGAAATACTTGTATATAAGTATGTATGAGCGTATAT
 
. : . : . : . : . : . :
JMFN018D03+ ATCATGTTCCTCTCATAAGCATTTGTTCGTAGTTCTCAATGGACTCGAGCCTCTGAAGGA
rJMFF027E19- TCATAAGCATTTGTTCGTAGTTCTCAATGGACTCGAGCCTCTGAAGGA
                      ____________________________________________________________
consensus ATCATGTTCCTCTCATAAGCATTTGTTCGTAGTTCTCAATGGACTCGAGCCTCTGAAGGA
 
. : . : . : . : . : . :
JMFN018D03+ GCAGCTGATGCTTAAACTTTTGGATGAATGCTTCCGCACTTTGGTTTATATCTTCCGTCG
rJMFF027E19- GCAGCTGATGCTTAAACTTTTGGATGAATGCTTCCGCACTTTGGTTTATATCTTCCGTCG
                      ____________________________________________________________
consensus GCAGCTGATGCTTAAACTTTTGGATGAATGCTTCCGCACTTTGGTTTATATCTTCCGTCG
 
. : . : . : . : . : . :
JMFN018D03+ TCGGCTTTCGTTCCAGCTTCTTTGCCGGTGGCGGCGCAACCGCAGCCTTCTTTGAGGCCA
rJMFF027E19- TCGGCTTTCGTTCCAGCTTCTTTGCCGGTGGCGGCGCAACCGCAGCCTTCTTTGAGGCCA
                      ____________________________________________________________
consensus TCGGCTTTCGTTCCAGCTTCTTTGCCGGTGGCGGCGCAACCGCAGCCTTCTTTGAGGCCA
 
. : . : . : . : . : . :
JMFN018D03+ CGGCGGTGCTTTTCCTCAGATCCATAACTGAACTCTCGCTTCTATCCTCTTCGATGCCGC
rJMFF027E19- CGGCGGTGCTTTTCTTCAGATCCATAACTGAACTCTCGCTTCTATCCTCTTCGATGCCGC
                      ____________________________________________________________
consensus CGGCGGTGCTTTTCTTCAGATCCATAACTGAACTCTCGCTTCTATCCTCTTCGATGCCGC
 
. : . : . : . : . : . :
JMFN018D03+ CGGCCTTCTGGCTGCTGCGACTGCGATTGTATTGATGATCAGATCTCACGGACTTCTTCT
rJMFF027E19- CGGCCTTCTGGCTGCTGCGACTGCGATTGTATTGATGATCAGATCTCACGGACTTCTTCT
                      ____________________________________________________________
consensus CGGCCTTCTGGCTGCTGCGACTGCGATTGTATTGATGATCAGATCTCACGGACTTCTTCT
 
. : . : . : . : . : . :
JMFN018D03+ CCATAACCGCTTAGCTTAGCTTC
rJMFF027E19- CCATAACCGCTTAGCTTAGCTTCTTTTTTTTTTTTTTTTTTTTNNGGGGGGNGGGGGNNA
                      ____________________________________________________________
consensus CCATAACCGCTTAGCTTAGCTTCTTTTTTTTTTTTTTTTTTTTNNGGGGGGNGGGGGNNA