Previous Contig 009486:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027C11Sequence601009486 (16)gb:AY776172_16282862e-32Nicotiana tabacum cyclin D-like protein mRNA, complete cds.701009486 (16)gb:AY776172_16282865e-43Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF021F13Sequence682009486 (16)gb:AY776172_16282862e-29Nicotiana tabacum cyclin D-like protein mRNA, complete cds.762009486 (16)gb:AY776172_16282865e-71Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF023N05Sequence683009486 (16)gb:AY776172_16282868e-34Nicotiana tabacum cyclin D-like protein mRNA, complete cds.739009486 (16)gb:AY776172_16282864e-53Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF031C21Sequence613009486 (16)gb:AY776172_16282862e-29Nicotiana tabacum cyclin D-like protein mRNA, complete cds.697009486 (16)gb:AY776172_16282861e-62Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF034J06Sequence673009486 (16)gb:AY776172_16282861e-45Nicotiana tabacum cyclin D-like protein mRNA, complete cds.708009486 (16)gb:AY776172_16282868e-65Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF036K11Sequence691009486 (16)gb:AY776172_16282863e-46Nicotiana tabacum cyclin D-like protein mRNA, complete cds.772009486 (16)gb:AY776172_16282864e-70Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF038C13Sequence684009486 (16)gb:AY776172_16282864e-30Nicotiana tabacum cyclin D-like protein mRNA, complete cds.943009486 (16)gb:AY776172_16282863e-98Nicotiana tabacum cyclin D-like protein mRNA, complete cds.
JMSF039C21Sequence681009486 (16)gb:AY776172_16282868e-34Nicotiana tabacum cyclin D-like protein mRNA, complete cds.865009486 (16)gb:AY776172_16282864e-89Nicotiana tabacum cyclin D-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039C21- GAGGGGAAAAAAGGGACAGGCGTGAAAGCAAGC
JMSF023N05- GGAGAGGGGAAAAAAGGGACAGGCGTGAAAGCAAGC
JMSF021F13- GAGGGGAAAAAAGGGACAGGCGTGAAAGCAAGC
JMSF038C13- GAGGGGAAAAAAGGGACAGGCGTGAAAGCAAGC
                      ____________________________________________________________
consensus GGAGAGGGGAAAAAAGGGACAGGCGTGAAAGCAAGC
 
. : . : . : . : . : . :
JMSF039C21- TCAGATAAAATCCTCTCCCTCTGCTTACTTCTCTGGTACTACCCTCCTCACCTCTCCAAT
JMFF027C11- GGTACTACCCTCCTCACCTCTCCAAT
JMSF023N05- TCAGATAAAATCCTCTCCCTCTGCTTACTTCTCTGGTACTACCCTCCTCACCTCTCCAAT
JMSF031C21- ACTACCCTCCTCACCTCTCCAAT
JMSF021F13- TCAGATAAAATCCTCTCCCTCTGCTTACTTCTCTGGTACTACCCTCCTCACCTCTCCAAT
JMSF038C13- TCAGATAAAATCCTCTCCCTCTGCTTACTTCTCTGGTACTACCCTCCTCACCTCTCCAAT
JMSF034J06- GGTACTACCCTCCTCACCTCTCCAAT
JMSF036K11- CTACCCTCCTCACCTCTCCAAT
                      ____________________________________________________________
consensus TCAGATAAAATCCTCTCCCTCTGCTTACTTCTCTGGTACTACCCTCCTCACCTCTCCAAT
 
. : . : . : . : . : . :
JMSF039C21- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMFF027C11- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMSF023N05- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMSF031C21- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMSF021F13- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMSF038C13- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMSF034J06- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
JMSF036K11- CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
                      ____________________________________________________________
consensus CTTCTCCCCTATCTCCCTATATCTCTCTCTATCTCTCTTTACCGTACTTCAGAGAGAGAA
 
. : . : . : . : . : . :
JMSF039C21- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMFF027C11- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMSF023N05- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMSF031C21- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMSF021F13- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMSF038C13- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMSF034J06- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
JMSF036K11- ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
                      ____________________________________________________________
consensus ACAAACACTGGGCTCAGCAGATATGATACCGGGTCAGAGATTGTGTTTGAGCTTTCCTTG
 
. : . : . : . : . : . :
JMSF039C21- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMFF027C11- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMSF023N05- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMSF031C21- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMSF021F13- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMSF038C13- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMSF034J06- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
JMSF036K11- AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
                      ____________________________________________________________
consensus AGTATTATGAGTAGAGGCTTTGCTGTCTTCTTCCCAAAAGAAGAAGGAGGAGAAGAAGAA
 
. : . : . : . : . : . :
JMSF039C21- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMFF027C11- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMSF023N05- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMSF031C21- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMSF021F13- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMSF038C13- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMSF034J06- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
JMSF036K11- GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
                      ____________________________________________________________
consensus GATGTTGTTTTCCCTTACCCATTTGCAAGAGAGTCGAGATTTGCAGCCCCAAAATCAGAT
 
. : . : . : . : . : . :
JMSF039C21- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTT-GGGAGGAT
JMFF027C11- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTT-GGGAGGAT
JMSF023N05- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTT-GGGAGGAT
JMSF031C21- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTTGGGGAGGAT
JMSF021F13- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTTGGGGAGGAT
JMSF038C13- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTTGGGGAGGAT
JMSF034J06- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTT-GGGAGGAT
JMSF036K11- CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTT-GGGAGGAT
                      ____________________________________________________________
consensus CTTTTCCCTTGATGGGCTCTTCTGTGAGGAGGAGAGGTTTGAGGATGATTT-GGGAGGAT
 
. : . : . : . : . : . :
JMSF039C21- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMFF027C11- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMSF023N05- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMSF031C21- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMSF021F13- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMSF038C13- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMSF034J06- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
JMSF036K11- GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
                      ____________________________________________________________
consensus GGTCTTGTTTCGAGAACGAGGTTTATCCCAAGATTAATGTCAAAAAGCCCTTGTCTTTCT
 
. : . : . : . : . : . :
JMSF039C21- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
JMFF027C11- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
JMSF023N05- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
JMSF031C21- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTACCCAAGGAAAAAC
JMSF021F13- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
JMSF038C13- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
JMSF034J06- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
JMSF036K11- TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
                      ____________________________________________________________
consensus TCGAATCTGACCTTTTCTGGGAGGATGATGAACTATTGACTCTGTTATCCAAGGAAAAAC
 
. : . : . : . : . : . :
JMSF039C21- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMFF027C11- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMSF023N05- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMSF031C21- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMSF021F13- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMSF038C13- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMSF034J06- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
JMSF036K11- AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
                      ____________________________________________________________
consensus AGACCCATTTTGGTTCTGGGATTCTTGATTTGGATGGGTCTTTAATGGTGGCTAGAAAGG
 
. : . : . : . : . : . :
JMSF039C21- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMFF027C11- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMSF023N05- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMSF031C21- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMSF021F13- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMSF038C13- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMSF034J06- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
JMSF036K11- AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
rJMSF038C13+ ACTGGATGTTTAAGGTCATTGGACACTATGGGGTTCAATGCTTNGACTGCT
                      ____________________________________________________________
consensus AGGCTCTGGACTGGATGTTTAAGGTCATTGGACACTAT-GGGTTCAATGCTTTGACTGCT
 
. : . : . : . : . : . :
JMSF039C21- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTC
JMFF027C11- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTG
JMSF023N05- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTC
JMSF031C21- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCA
JMSF021F13- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCA
JMSF038C13- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCAG
JMSF034J06- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCAGAAGGATAAG
JMSF036K11- GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCAGAAGGATAAG
rJMSF038C13+ GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCAGAAGGATAAG
rJMSF039C21+ TTTCAGAAGGATAAG
                      ____________________________________________________________
consensus GTTTTGGCCGTCAACTACTTTGATAGGCTTATATCTGGTGTATCCTTTCAGAAGGATAAG
 
. : . : . : . : . : . :
JMSF034J06- CCATGGATGAGCCAGCTTGCTGCTGTGGCTTGTCTTTCCATAGCTGCA
JMSF036K11- CCATGGATGAGCCAGCTTGCTGCTGTGGCTTGTCTTTCCATAGCTGC-AAAGTAGAGGAG
rJMSF038C13+ CCATGGATGAGCCAGCTTGCTGCTGTGGCTTGTCTTTCCATAGCTGCAAAAGTAGAGGAG
rJMSF039C21+ CCATGGATGAGCCAGCTTGCTGCTGTGGCTTGTCTTTCCATAGCTGCAAAAGTAGAGGAG
                      ____________________________________________________________
consensus CCATGGATGAGCCAGCTTGCTGCTGTGGCTTGTCTTTCCATAGCTGCAAAAGTAGAGGAG
 
. : . : . : . : . : . :
JMSF036K11- ATTGAAGTCC
rJMSF038C13+ ATTGAAGTCCCTCTCCCGTTAGACTTCCAAGTGGCAGATTCTAAGTATATGTTCGAGGCG
rJMSF039C21+ ATTGAAGTCCCTCTCCTGTTAGACTTCCAAGTGGCAGATTCTAAGTATATGTTCGAGGCG
rJMSF021F13+ GCAGATTCTAAGTATATGTTCGAGGCG
rJMSF036K11+ GTTAGACTTCCAAGT-GCAGATTCTAAGTATATGTTCGAGGCG
                      ____________________________________________________________
consensus ATTGAAGTCCCTCTCCTGTTAGACTTCCAAGTGGCAGATTCTAAGTATATGTTCGAGGCG
 
. : . : . : . : . : . :
rJMSF038C13+ AAAACCATTCAGAGAATGGAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
rJMSF039C21+ AAAACCATTCAGAGAATGGAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
rJMSF034J06+ ATTCAGAGAATGGAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
rJMSF031C21+ GAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
rJMSF021F13+ AAAACCATTCAGAGAATGGAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
rJMSF036K11+ AAAACCATTCAGAGAATGGAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
                      ____________________________________________________________
consensus AAAACCATTCAGAGAATGGAGCTGCTTGTGCTCTCTACTCTTCAGTGGAGGATGAACCCA
 
. : . : . : . : . : . :
rJMSF038C13+ GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
rJMSF039C21+ GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
rJMSF034J06+ GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
rJMSF031C21+ GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
rJMSF021F13+ GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
rJMSF036K11+ GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
rJMSF023N05+ ATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
                      ____________________________________________________________
consensus GTGACCCCAATCTCGTTCCTTGACCATATTATTAGGAGATTTGGATTGAAGGGCAACCTG
 
. : . : . : . : . : . :
rJMSF038C13+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMSF039C21+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMSF034J06+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMSF031C21+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMSF021F13+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMSF036K11+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMSF023N05+ CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
rJMFF027C11+ TCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
                      ____________________________________________________________
consensus CATTATGAATTCTTGAGGTCCTGTGAGCACATCATTCTCTCTGTCATTGCTGATTCTCGG
 
. : . : . : . : . : . :
rJMSF038C13+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMSF039C21+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMSF034J06+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMSF031C21+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMSF021F13+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMSF036K11+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMSF023N05+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
rJMFF027C11+ CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
                      ____________________________________________________________
consensus CTACTGCATTATCTACCGTCTGTTATTGCCACTGCTACGATGTTAATTGCTATCAAAGAG
 
. : . : . : . : . : . :
rJMSF038C13+ GTTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMSF039C21+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMSF034J06+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMSF031C21+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMSF021F13+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMSF036K11+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMSF023N05+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
rJMFF027C11+ ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
                      ____________________________________________________________
consensus ATTGAATCTTGCAATGCTGCTGAATACGAGAATGAACTCGTGGCTTTACTCAATGTCAGC
 
. : . : . : . : . : . :
rJMSF038C13+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMSF039C21+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMSF034J06+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMSF031C21+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMSF021F13+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMSF036K11+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMSF023N05+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
rJMFF027C11+ AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
                      ____________________________________________________________
consensus AAGGAAGAGGTAGACGAGTGTTATAATCTGATTCTAGAGGTAACTGGCCATCATGGCAAA
 
. : . : . : . : . : . :
rJMSF038C13+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMSF039C21+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMSF034J06+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMSF031C21+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMSF021F13+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMSF036K11+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMSF023N05+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
rJMFF027C11+ CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
                      ____________________________________________________________
consensus CAGCGTTTTCAGAGCCTTAAGCGCAAATATGAATCTGCACCGGGCAGTCCAAATGGTGTT
 
. : . : . : . : . : . :
rJMSF038C13+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMSF039C21+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMSF034J06+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMSF031C21+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMSF021F13+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMSF036K11+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMSF023N05+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
rJMFF027C11+ ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
                      ____________________________________________________________
consensus ATCGATGCATATTTTAGCTGCGAAAGTTCTAACGATTCCTGGGCATTGGCACCATCGGTT
 
. : . : . : . : . : . :
rJMSF038C13+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMSF039C21+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMSF034J06+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMSF031C21+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMSF021F13+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMSF036K11+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMSF023N05+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
rJMFF027C11+ GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
                      ____________________________________________________________
consensus GGTTCCTCACCGGAGCTGCTCTACAAGAGAAGCAGATCTCGAGACCAGCAAATGAGACTG
 
. : . : . : . : . : . :
rJMSF038C13+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMSF039C21+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMSF034J06+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMSF031C21+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMSF021F13+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMSF036K11+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMSF023N05+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
rJMFF027C11+ GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
                      ____________________________________________________________
consensus GCCCCACTGGGCAGTGTTCGTGGTTGTGGGTAGCAGTTTGATCTCATCGAGGTTCCATTC
 
. : . : . : . : . : . :
rJMSF038C13+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMSF039C21+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMSF034J06+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMSF031C21+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMSF021F13+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMSF036K11+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMSF023N05+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
rJMFF027C11+ TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
                      ____________________________________________________________
consensus TTGGATTCATCTAATGTTTCGGTGATGGTACTACTTAATCTCCTTTTTAGCTATGTGCTC
 
. : . : . : . : . : . :
rJMSF038C13+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTT
rJMSF039C21+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTTTTGAATA
rJMSF034J06+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTNCACCTAGACGTTT
rJMSF031C21+ TTAAAATGGGATGCNGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTTT
rJMSF021F13+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTTTTGAATA
rJMSF036K11+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACG-TTTGAATA
rJMSF023N05+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTTTTGAATA
rJMFF027C11+ TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTTTTGAATA
                      ____________________________________________________________
consensus TTAAAATGGGATGCTGTTGTTGTATGACATTCCATATGTTTCA-CTAGACGTTTTGAATA
 
. : . : . : . : . : . :
rJMSF039C21+ GA
rJMSF021F13+ GACCCGTG
rJMSF036K11+ GACCCGTG
rJMSF023N05+ GACCCGTGTGCTGGTTTTTATGGATGCTAAATATCGACTCCACTTTTACCCCCCTTGAGT
rJMFF027C11+ GACCCGTGTGCTGGTTTTTATGGATGCTAAATATCGACTCCACTTTTACCCCCCTTGAGT
                      ____________________________________________________________
consensus GACCCGTGTGCTGGTTTTTATGGATGCTAAATATCGACTCCACTTTTACCCCCCTTGAGT
 
. : . : . : . : . : . :
rJMSF023N05+ TGCATCCTAGCATTTATTGCTTTGCGATA
rJMFF027C11+ TGCATCCTAGCATTTATTGCTTTGCGATATGAACATTGGCAATGAATATCAAGAAAGGCA
                      ____________________________________________________________
consensus TGCATCCTAGCATTTATTGCTTTGCGATATGAACATTGGCAATGAATATCAAGAAAGGCA