Previous Contig 009483:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF027B17Sequence567004058 (10)gb:AY037232_15601262e-44Arabidopsis thaliana At2g41900/T6D20.20 mRNA, complete cds.>gb:AY093957_1575463 717009483 (3)gb:AC097368_17366586e-30Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.
JMFF036F23Sequence523004058 (10)gb:AY037232_15601263e-40Arabidopsis thaliana At2g41900/T6D20.20 mRNA, complete cds.>gb:AY093957_1575463 666009483 (3)gb:AC097368_17366581e-23Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.
JMSF039D19Sequence208004058 (10)735009483 (3)gb:AC097368_17366584e-31Oryza sativa chromosome 3 BAC OSJNBb0017F17 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039D19+ TGAGCGCCCGCCTTTCTGTTTTCGCT
                      ____________________________________________________________
consensus TGAGCGCCCGCCTTTCTGTTTTCGCT
 
. : . : . : . : . : . :
rJMSF039D19+ CAGCGTGAGAAACAGCATCAGCAGCTACGCAGCCTGAGCTCTCGGGATCTTGGCTCCAAC
rJMFF036F23+ CTCCAAC
rJMFF027B17+ AGCGTGAGAAACAGCATCAGCAGCTACGCAGCCTGAGCTCTCGGGATCTTGGCTCCAAC
                      ____________________________________________________________
consensus CAGCGTGAGAAACAGCATCAGCAGCTACGCAGCCTGAGCTCTCGGGATCTTGGCTCCAAC
 
. : . : . : . : . : . :
rJMSF039D19+ AACCA-CAACACCTCTATTGTTGGGTCCCCAGTGAGCAATTCTTGGTCTAACTGGGGTTC
rJMFF036F23+ AACCACCAACACCTCTATTGTTGGGTCCCCAGTGAGCAATTCTTGGTCTAACTGGGGTTC
rJMFF027B17+ AACCA-CAACACCTCTATTGTTGGGTCCCCAGTGAGCAATTCTTGGTCTAACTGGGGTTC
                      ____________________________________________________________
consensus AACCA-CAACACCTCTATTGTTGGGTCCCCAGTGAGCAATTCTTGGTCTAACTGGGGTTC
 
. : . : . : . : . : . :
rJMSF039D19+ CCCCAGTACAAGACCTGACTGGTCCTTCAACGGCGATGAACCAAGCCATCTCCGTAGATC
rJMFF036F23+ CCCCAGTACAAGACCTGACTGGTCCTTCAACGGCGATGAACCAAGCCATCTCCGTAGATC
rJMFF027B17+ CCCCAGTACAAGACCTGACTGGTCCTTCAACGGCGATGAACCAAGCCATCTCCGTAGATC
                      ____________________________________________________________
consensus CCCCAGTACAAGACCTGACTGGTCCTTCAACGGCGATGAACCAAGCCATCTCCGTAGATC
 
. : . : . : . : . : . :
rJMSF039D19+ ATCTTCTTTCGAGCGGCTCAACAACAACAACAACAGCGAGGAGCCCGATCTGTCATGGGT
rJMFF036F23+ ATCTTCTTTCGAGCGGCTCAACAACAACAACAACAGCGAGGAGCCCGATCTGTCATGGGT
rJMFF027B17+ ATCTTCTTTCGAGCGGCTCAACAACAACAACAACAGCGAGGAGCCCGATCTGTCATGGGT
                      ____________________________________________________________
consensus ATCTTCTTTCGAGCGGCTCAACAACAACAACAACAGCGAGGAGCCCGATCTGTCATGGGT
 
. : . : . : . : . : . :
rJMSF039D19+ CCAATCTCTTGTCAAAGAATCACCACCTGAGATGAAAGATAAGTCTGCAGCGCCAGCTCC
rJMFF036F23+ CCAATCTCTTGTCAAAGAATCACCACCTGAGATGAAAGATAAGTCTGCAGCGCCAGCTCC
rJMFF027B17+ CCAATCTCTTGTCAAAGAATCACCACCTGAGATGAAAGATAAGTCTGCAGCGCCAGCTCC
                      ____________________________________________________________
consensus CCAATCTCTTGTCAAAGAATCACCACCTGAGATGAAAGATAAGTCTGCAGCGCCAGCTCC
 
. : . : . : . : . : . :
rJMSF039D19+ CCGGGGCGCTGTTCCATCCGGTGAGGGTTTAAAATTCAGTACTCAGACTGATTCCATCGA
rJMFF036F23+ CCGGGGCGCTGTTCCATCCGGTGAGGGTTTAAAATTCAGTACTCAGACTGATTCCATCGA
rJMFF027B17+ CCGGGGCGCTGTTCCATCCGGTGAGGGTTTAAAATTCAGTACTCAGACTGATTCCATCGA
                      ____________________________________________________________
consensus CCGGGGCGCTGTTCCATCCGGTGAGGGTTTAAAATTCAGTACTCAGACTGATTCCATCGA
 
. : . : . : . : . : . :
rJMSF039D19+ TCAATCTGTTATAGGTACTTGGCTTGAGCAGATGCAACTCGATCAACCCGTAGTCTAGTG
rJMFF036F23+ TCAATCTGTTATAGGTACTTGGCTTGAGCAGATGCAACTCGATCAACCCGTAGTCTAGTG
rJMFF027B17+ TCAATCTGTTATAGGTACTTGGCTTGAGCAGATGCAACTCGATCAACCCGTAGTCTAGTG
                      ____________________________________________________________
consensus TCAATCTGTTATAGGTACTTGGCTTGAGCAGATGCAACTCGATCAACCCGTAGTCTAGTG
 
. : . : . : . : . : . :
rJMSF039D19+ GGAAGAAGAAGAAAGATTCATNTTCNCCTTATTCTTAGGGAAGCATGTAGTGTAGTANTA
rJMFF036F23+ GGAAGAAGAAGAAAGATTCATTTTCACCTTATTCTTAGGGAAGCATGTAGTGTACTACTA
rJMFF027B17+ GGAAGAAGAAGAAAGATTCATTTTCACCTTATTCTTAGGGAAGCATGTAGTGTACTACTA
                      ____________________________________________________________
consensus GGAAGAAGAAGAAAGATTCATTTTCACCTTATTCTTAGGGAAGCATGTAGTGTACTACTA
 
. : . : . : . : . : . :
rJMSF039D19+ CTGTTTTGGAGGTAAATTTTTTTGGCCGCCGGNGGAATCAAATGCAGAATCCGGTAAGCT
rJMFF036F23+ CTGTTTTGGAGGTAAATTTTTTTGGCCGCCGGTGGAATCAAATGCAGAATCCGGTAAGCT
rJMFF027B17+ CTGTTTTGGAGGTAAATTTTTTTGGCCGCCGGTGGAATCAAATGCAGAATCCGGTAAGCT
                      ____________________________________________________________
consensus CTGTTTTGGAGGTAAATTTTTTTGGCCGCCGGTGGAATCAAATGCAGAATCCGGTAAGCT
 
. : . : . : . : . : . :
rJMSF039D19+ AAAGGCAAAATTTCCCAGCAAGTTTTCATTACATTTCATTNGATTATATCATTATTTGTT
rJMFF036F23+ AAAGGCAAAATTTCCCAGCAAGTTTTCATTACATTTCATTTGATTATATCATTATTTGTT
rJMFF027B17+ AAAGGCAAAATTTCCCAGCAAGTTTTCATTACATTTCATTTGATTATATCATTATTTGTT
                      ____________________________________________________________
consensus AAAGGCAAAATTTCCCAGCAAGTTTTCATTACATTTCATTTGATTATATCATTATTTGTT
 
. : . : . : . : . : . :
rJMSF039D19+ CAAATACATCTTTAATGTTTCAAANTGTTGTCCGGGCTTGCATCAAACATCCCCAGTCCT
rJMFF036F23+ CAAATACATCTTTAATGTTTCAAATTGTTGTCTGGGCTTGCATCAAACATCCCCAGTCCT
rJMFF027B17+ CAAATACATCTTTAATGTTTCAAATTGTTGTCTGGGCTTGCATCAAACATCCCCAGTCCT
                      ____________________________________________________________
consensus CAAATACATCTTTAATGTTTCAAATTGTTGTCTGGGCTTGCATCAAACATCCCCAGTCCT
 
. : . : . : . : . : . :
rJMSF039D19+ GGCATGTNTGANTTGCCTTTATGTATGATGTANAACTCAAATGAAATT
rJMFF036F23+ GGCATGT-TGAATTGCCTTTATGTATGATGTAAAACTCAAATGAAATTTGTAATATTTAT
rJMFF027B17+ GGCATGT-TGAATTGCCTTTATGTATGATGTAAAACTCAAATGAAATTTGTAATATTTAT
                      ____________________________________________________________
consensus GGCATGT-TGAATTGCCTTTATGTATGATGTAAAACTCAAATGAAATTTGTAATATTTAT