Previous Contig 009480:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026O09Sequence556001849 (7)sp|P21343|PFPB_SOLTU2e-49Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.829009480 (9)pir|B36094|B36094e-114diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMFF027A19Sequence476001849 (7)sp|P21343|PFPB_SOLTU4e-51Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.756009480 (9)pir|B36094|B36094e-101diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMFF043I01Sequence654001849 (7)sp|P21343|PFPB_SOLTU1e-68Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.463009480 (9)pir|T01470|T014702e-45diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF005L08Sequence366001849 (7)sp|P21343|PFPB_SOLTU7e-29Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.101009480 (9)
JMSF011A02Sequence272001849 (7)gb:AF095520_17677651e-14Citrus X paradisi pyrophosphate-dependent phosphofructokinase beta subunit (PPi-776009480 (9)pir|B36094|B36094e-106diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF025B13Sequence661001849 (7)sp|P21343|PFPB_SOLTU2e-86Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.737009480 (9)pir|B36094|B36094e-105diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF030H21Sequence608006673 (2)sp|P21343|PFPB_SOLTU2e-76Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.645009480 (9)pir|B36094|B360948e-92diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -
JMSF030L23Sequence661001849 (7)sp|P21343|PFPB_SOLTU8e-87Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.762009480 (9)sp|P21343|PFPB_SOLTU2e-97Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.
JMSF047A08Sequence661006673 (2)sp|P21343|PFPB_SOLTU4e-86Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.772009480 (9)pir|B36094|B36094e-107diphosphate-fructose-6-phosphate 1-phosphotransferase (EC 2.7.1.90) beta chain -

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF047A08+ AT
rJMFF026O09+ CTTATAGATTTCATTCCTGAGGTCCAGCAGCTCATTGCAGAATNGAAT
rJMSF030L23+ CCAGCAGCTCATTGCAGNATTGNAT
rJMSF011A02+ AT
                      ____________________________________________________________
consensus CTTATAGATTTCATTCCTGAGGTCCAGCAGCTCATTGCAGAATTGAAT
 
. : . : . : . : . : . :
rJMSF047A08+ GAAATTTTGGCTCATGATGTTGTAGATGAAGCTGGTGTTTGGAAAAAGAAATTGAGTCCG
rJMFF026O09+ GAAATTTTGGCTCATGGTGTTGTAGATGATGCTGGTGTTTGGAAAAGGAAACTGACCCCA
rJMSF030L23+ GAAATTTTGGCTCATGGTGTTGTAGATGATGCTGGTG-TTGGAAAAGGAAACTGACCCCA
rJMSF025B13+ AATTTTGGCTCATGGTGTTGTAGATGATGCTGGTGTTTGGAAAAGGAAACTGACCCCA
rJMSF011A02+ GAANTTTTGGCTCATGGTGTTGTAGATGATGCTGGTGTTTGGAAAAGGAAACTGACCCCA
rJMFF027A19+ TTGGAAAAGGAAACTGACCCCA
                      ____________________________________________________________
consensus GAAATTTTGGCTCATGGTGTTGTAGATGATGCTGGTGTTTGGAAAAGGAAACTGACCCCA
 
. : . : . : . : . : . :
rJMSF030H21+ CCTCAAGCTATTAGGGAGCAATTGCTGCTGGAG
rJMSF047A08+ CAATGTCTACAGCTTTTTGAGATATTACCTCAAGCTATTAGGGAGCAATTGCTGCTGGAG
rJMFF026O09+ CAATGTCTGCAGCTTTTTGAGTTGTTGCCTCAAGCTATTCAGGATCAATTACTGCTTGAG
rJMSF030L23+ CAATGTCTGCAGC-TTTTGAGTTGTTGCCTCAAGCTATTCAGGATCAATTACTGCTTGAG
rJMSF025B13+ CAATGTCTGCAGCTTTTTGAGTTGTTGCCTCAAGCTATTCAGGATCAATTACTGCTTGAG
rJMSF011A02+ CAATGTCTGCAGCTTTTTGAGTTGTTGCCTCAAGCTATTCAGGATCAATTACTGCTTGAG
rJMFF027A19+ CAATGTCTGCAGCTTTTTGAGTTGTTGCCTCAAGCTATTCAGGATCAATTACTGCTNGAG
                      ____________________________________________________________
consensus CAATGTCTGCAGCTTTTTGAGTTGTTGCCTCAAGCTATTCAGGATCAATTACTGCTTGAG
 
. : . : . : . : . : . :
rJMSF030H21+ AGAGATCCACATGGCAATGTCCAGGTTGCCAAAATTGAAACAGAAAAAATGCTTATTCAA
rJMSF047A08+ AGAGATCCACATGGCAATGTCCAGGTTGCCAAAATTGAAACAGAAAAAATGCTTATTCAA
rJMFF026O09+ AGAGATCCACATGGCAATGTGCAGGTTGCCAAGATTGAAACTGAAAAAATGCTTATTCAA
rJMSF030L23+ AGAGATCCACATGGCAATGTGCAGGTTGCCAAGATTGAAACTGAAAAAATGCTTATTCAA
rJMSF025B13+ AGAGATCCACATGGCAATGTGCAGGTTGCCAAGATTGAAACTGAAAAAATGCTTATTCAA
rJMSF011A02+ AGAGATCCACATGGCAATGTGCAGGTTGCCAAGATTGAAACTGAAAAAATGCTTATTCAA
rJMFF027A19+ AGAGATCCACATGGCAATGTGCAGGTTGCCAAGATTGAAACTGAAAAAATGCTTATTCAA
                      ____________________________________________________________
consensus AGAGATCCACATGGCAATGTGCAGGTTGCCAAGATTGAAACTGAAAAAATGCTTATTCAA
 
. : . : . : . : . : . :
rJMSF030H21+ ATGGTTGAGACCGAGTTGGATCAGAGGAAACAAATTGGTCAATATAATTGCGAATTTAAG
rJMSF047A08+ ATGGTTGAGACCGAGTTGGATCAGAGGAAACAAATTGGTCAATATAATTGCGAATTTAAG
rJMFF026O09+ ATGGTTGAAACAGAGTTGGAGTTGAGAAGGCAGAGTGGTTCATATAATGGTCAATTCAAG
rJMSF030L23+ ATGGTTGAAACAGAGTTGGAGTTGAGAAGGCAGAGTGGTTCATATAATGGTCAATTCAAG
rJMSF025B13+ ATGGTTGAAACAGAGTTGGAGTTGAGAAGGCAGAGTGGTTCATATAATGGTCAATTCAAG
rJMSF011A02+ ATGGTTGAAACAGAGTTGGAGTTGAGAAGGCAGAGTGGTTCATATAATGGTCAATTCAAG
rJMFF027A19+ ATGGTTGAAACAGAGTTGGAGTTGAGAAGGCAGAGTGGTTCATATAATGGTCAATTCAAG
                      ____________________________________________________________
consensus ATGGTTGAAACAGAGTTGGAGTTGAGAAGGCAGAGTGGTTCATATAATGGTCAATTCAAG
 
. : . : . : . : . : . :
rJMSF030H21+ GGGCAGTCACACTTTTTCGGTTATGAAGGAAGGTGTGGCATGCCGTCCAACTTTGATGCC
rJMSF047A08+ GGGCAGTCACACTTTTTCGGTTATGAAGGAAGGTGTGGCATGCCGTCCAACTTTGATGCC
rJMFF026O09+ GGGCAGTCCCACTTTTTCGGTTATGAAGGAAGGTGTGGCTTGCCATCAAATTTTGATGCC
rJMSF030L23+ GGGCAGTCCCACTTTTTCGGTTATGAAGGAAGGTGTGGCTTGCCATCAAATTTTGATGCC
rJMSF025B13+ GGGCAGTCCCACTTTTTCGGTTATGAAGGAAGGTGTGGCTTGCCATCAAATTTTGATGCC
rJMSF011A02+ GGGCAGTCCCACTTTTTCGGTTATGAAGGAAGGTGTGGCTTGCCATCAAATTTTGATGCC
rJMFF027A19+ GGGCAGTCCCACTTTTTCGGTTATGAAGGAAGGTGTGGCTTGCCATCAAATTTTGATGCC
                      ____________________________________________________________
consensus GGGCAGTCCCACTTTTTCGGTTATGAAGGAAGGTGTGGCTTGCCATCAAATTTTGATGCC
 
. : . : . : . : . : . :
rJMSF030H21+ ACATACTGTTATGCATTGGGNTATGGTGCGGGGGCACTGCTTCAGAGTGGGAAGACAGGA
rJMSF047A08+ ACATACTGTTATGCATTGGGTTATGGTGCGGGGGCACTGCTTCAGAGTGGGAAGACAGGA
rJMFF043I01+ CTGGGGCACTACTTCAAAGTGGGAAGACAGGA
rJMFF026O09+ ACATACTGTTATGCCTTGGGCTATGGTGCTGGGGCACTACTTCAAAGTGGGAAGACAGGA
rJMSF030L23+ ACATACTGTTATGCCTTGGGCTATGGTGCTGGGGCACTACTTCAAAGTGGGAAGACAGGA
rJMSF025B13+ ACATACTGTTATGCCTTGGGCTATGGTGCTGGGGCACTACTTCAAAGTGGGAAGACAGGA
rJMSF011A02+ ACATACTGTTATGCCTTGGGCTATGGTGCTGGGGCACTACTTCAAAGTGGGAAGACAGGA
rJMFF027A19+ ACATACTGTTATGCCTTGGGCTATGGTGCTGGGGCACTACTTCAAAGTGGGAAGACAGGA
                      ____________________________________________________________
consensus ACATACTGTTATGCCTTGGGCTATGGTGCTGGGGCACTACTTCAAAGTGGGAAGACAGGA
 
. : . : . : . : . : . :
rJMSF030H21+ TTGATATCNTCGGTTGGGAACTTGGCTGCCCCAGTTTCAGAATGGACTGTTGGCGGAACA
rJMSF047A08+ TTGATATCATCGGTTGGGAACTTGGCTGCCCCAGTTTCAGAATGGACTGTTGGCGGAACA
rJMFF043I01+ TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
rJMFF026O09+ TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
rJMSF030L23+ TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
rJMSF025B13+ TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
rJMSF011A02+ TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
rJMFF027A19+ TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
                      ____________________________________________________________
consensus TTGATATCATCGGTTGGAAACTTGGCTGCTCCAGTTTCAGATTGGACTGTGGGCGGAACT
 
. : . : . : . : . : . :
rJMSF030H21+ GCACTAACAGCAATGATGGATGTTGAGAGAAGACATGGTAAATACAAGCCTGTGATAAAG
rJMSF047A08+ GCACTAACAGCAATGATGGATGTTGAGAGAAGACATGGTAAATACAAGCCTGTGATAAAG
rJMFF043I01+ GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
rJMFF026O09+ GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
rJMSF030L23+ GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
rJMSF025B13+ GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
rJMSF011A02+ GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
rJMFF027A19+ GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
                      ____________________________________________________________
consensus GCTCTGACTTCATTGATGGATGTTGAGAGAAGACATGGTAAATTCAAGCCTGTGATAAAG
 
. : . : . : . : . : . :
rJMSF030H21+ AAAGCTATGGTAGAACTTGATGGTGCACCATTTAAGAAATTTGCATCAATGCGGGGAGAG
rJMSF047A08+ AAAGCTATGGTAGAACTTGATGGTGCACCATTTAAGAAATTTGCATCAATGCGGGGAGAG
rJMFF043I01+ AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
rJMFF026O09+ AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
rJMSF030L23+ AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
rJMSF025B13+ AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
rJMSF011A02+ AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
rJMFF027A19+ AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
                      ____________________________________________________________
consensus AAAGCAATGGTGGAGCTTGACGGTGCTCCATTCAAGAAATTTGCATCAATGCGTGAAGAA
 
. : . : . : . : . : . :
rJMSF030H21+ TGGGCTATAAAGAACCGTTATCTGAGTCCTGGTCCCATTCAATTCGTGGGTCCAATTGCA
rJMSF047A08+ TGGGCTATAAAGAACCGTTATCTGAGTCCTGGTCCCATTCAATTCGTGGGTCCAATTGCA
rJMFF043I01+ TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCA
rJMFF026O09+ TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCAGTTTCT
rJMSF030L23+ TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCAGTTTCT
rJMSF025B13+ TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCAGTTTCT
rJMSF011A02+ TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCAGTTTCT
rJMFF027A19+ TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCAGTTTCT
                      ____________________________________________________________
consensus TGGGCCCTAAAGAACCGCTACTTGAATCCTGGTCCAATTCAATTTGTTGGTCCAGTTTCT
 
. : . : . : . : . : . :
rJMSF030H21+ GATAAAGTNAATCACACCTTACTGTTGGAGCT
rJMSF047A08+ GATAAAGTAAATCACACCTTACTGTTGGAGCT
rJMFF026O09+ GATCAAGTAAATCACACATTGCTTTTGGAGCT
rJMSF030L23+ GATCAAGTAAATCACACATTGCTTTTGGAGCTCGGGGCTTAATCCTAAGTGAACAGAGAA
rJMSF025B13+ GATCAAGTAAATCACACATTGCTTTTGGAGCTCGGGGCTTAATCCTAAGTGAACAGAGAA
rJMSF011A02+ GATCAAGTAAATCACACATTGCTTTTGGAGCTCGGGGCTTAATCCTAAGTGAACAGAGAA
rJMSF005L08+ TAATCNTAAGTGANCAGAGAN
rJMFF027A19+ GATCAAGTAAATCACACATTGCTTTTGGAGCTCGGGGCTTAATCCTAAGTGAACAGAGAA
                      ____________________________________________________________
consensus GATCAAGTAAATCACACATTGCTTTTGGAGCTCGGGGCTTAATCCTAAGTGAACAGAGAA
 
. : . : . : . : . : . :
rJMSF030L23+ AGTAGTAAATCACTCTATTTTAAAGGACTATTCCATGTAGAGACGCAATTATTTTCTTTC
rJMSF025B13+ AGTAGTAAATCACTCTATTTTAAAGGACTATTCCATGTAGAGACGCAATTATTTTCTTTC
rJMSF011A02+ AGTAGTAAATCACTCTATTTTAAAGGACTATTCCATGTAGAGACGCAATTATTTTCTTTC
rJMSF005L08+ AGTAGTAAATCACTCTNTTTTAAAGGACTATTCCATGTAGAGACGCAATTATTTTCTNTC
rJMFF027A19+ AGTAGTAAATCACTCTATTTTAAAGGACTATTCCATGTAGAGACGCAATTATTTTCTTTC
                      ____________________________________________________________
consensus AGTAGTAAATCACTCTATTTTAAAGGACTATTCCATGTAGAGACGCAATTATTTTCTTTC
 
. : . : . : . : . : . :
rJMSF030L23+ CTGTGATTGGCTTGTACTT
rJMSF025B13+ CTGTGATTGGCTTGTACTT
rJMSF011A02+ CTGTGATTGGCTTGTACTTTTAAGCACTAGTTTCATACTTTTCGAATGTGAAC
rJMSF005L08+ CTGTGATTGGCTTGTACTTT
rJMFF027A19+ CTGTGATTGGCTTGTACTTTTAAGCACTAGTTTCATACTTTTCGAATGTGAACAATCAAT
                      ____________________________________________________________
consensus CTGTGATTGGCTTGTACTTTTAAGCACTAGTTTCATACTTTTCGAATGTGAACAATCAAT