Previous Contig 009477:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026P14Sequence517014603gb:AY087566_15725964e-44Arabidopsis thaliana clone 36702 mRNA, complete sequence.786009477 (2)gb:AP004868_18462771e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P004
JMFS088D05Sequence517009477 (2)gb:AP004868_18462778e-34Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P004

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026P14- GCTTTG
                      ____________________________________________________________
consensus GCTTTG
 
. : . : . : . : . : . :
rJMFF026P14- TAACTTAGCACCTATAAATAGGACTTCAAAGACATTTGGAGGCAATTCAAGAAATTCTGA
                      ____________________________________________________________
consensus TAACTTAGCACCTATAAATAGGACTTCAAAGACATTTGGAGGCAATTCAAGAAATTCTGA
 
. : . : . : . : . : . :
rJMFF026P14- TACACTTAAGGCACCATTTCAAAGCATTCTTAGTACTATCCTTCTTAGGCATTACATTTT
                      ____________________________________________________________
consensus TACACTTAAGGCACCATTTCAAAGCATTCTTAGTACTATCCTTCTTAGGCATTACATTTT
 
. : . : . : . : . : . :
rJMFF026P14- TCACCTCACTTTTGCAATATACTTTCCGGTGAATCCACCAACTTCCGGTTGTGTTGGACC
                      ____________________________________________________________
consensus TCACCTCACTTTTGCAATATACTTTCCGGTGAATCCACCAACTTCCGGTTGTGTTGGACC
 
. : . : . : . : . : . :
rJMFF026P14- TCCGTGGGCATCTCAAAAGTCCTAAACCAACACGTGTGAAGCGAGAAGTTTTTTTTAAAC
                      ____________________________________________________________
consensus TCCGTGGGCATCTCAAAAGTCCTAAACCAACACGTGTGAAGCGAGAAGTTTTTTTTAAAC
 
. : . : . : . : . : . :
JMFS088D05+ CCGTGAAGGTGTTGGTGGCATCT
rJMFF026P14- ATCAAAACGAAGTCGTTTTAGACCGTGGCCCACACAGCCGTGAAGGTGTTGGTGGCATCT
                      ____________________________________________________________
consensus ATCAAAACGAAGTCGTTTTAGACCGTGGCCCACACAGCCGTGAAGGTGTTGGTGGCATCT
 
. : . : . : . : . : . :
JMFS088D05+ GTAACACTCCCATTCGCAACCTCCAAATCAACAGCAGATTTAGCTTGCACAAGACTGTCT
rJMFF026P14- GTAACACTCCCATTCGCAACCTCCAAATCAACAGCAGATTTAGCTTGCACAAGACTGTCT
                      ____________________________________________________________
consensus GTAACACTCCCATTCGCAACCTCCAAATCAACAGCAGATTTAGCTTGCACAAGACTGTCT
 
. : . : . : . : . : . :
JMFS088D05+ AGGAAGTCCATCACAATGGGGTCGGTCCAGGGAGCTCCGGTTGGGGCATCAGAACCTGCC
rJMFF026P14- AGGAAGTCCATCACAATGGGGTCGGTCCAGGGAGCTCCGGTTGGGGCATCAGAACCTGCC
                      ____________________________________________________________
consensus AGGAAGTCCATCACAATGGGGTCGGTCCAGGGAGCTCCGGTTGGGGCATCAGAACCTGCC
 
. : . : . : . : . : . :
JMFS088D05+ ACCCATCCAAGATGGCCACCTTGAGGTGTGACTATCAGCAAACAATTTGGGTTTTCCTCA
rJMFF026P14- ACCCATCCAAGATGGCCACCTTGAGGTGTGACTATCAGCAAACAATTTGGGTTTTCCTCA
                      ____________________________________________________________
consensus ACCCATCCAAGATGGCCACCTTGAGGTGTGACTATCAGCAAACAATTTGGGTTTTCCTCA
 
. : . : . : . : . : . :
JMFS088D05+ ATATCCTTTCGAGGGATTCCTCTTGATGGAGCAATTGGATCATTTGCAGCCTGGATGCAA
rJMFF026P14- ATATCCTTTCGAGGGATTCCTCTTGATGGAGCAATTGGATCATTTGCAGCCTGGATGCAA
                      ____________________________________________________________
consensus ATATCCTTTCGAGGGATTCCTCTTGATGGAGCAATTGGATCATTTGCAGCCTGGATGCAA
 
. : . : . : . : . : . :
JMFS088D05+ AGTAAAGGAATGCAGACACTTTTAATTGAATCTGAGCTACTTGAGTTTGAATAATAATCA
rJMFF026P14- AGTAAAGGAATGCAGACACTTTTAATTGAATCTGAGCTACTTGAGTTTGAATAATAATCA
                      ____________________________________________________________
consensus AGTAAAGGAATGCAGACACTTTTAATTGAATCTGAGCTACTTGAGTTTGAATAATAATCA
 
. : . : . : . : . : . :
JMFS088D05+ TCCGCTGACTTAAATCCAAATGAAACTCT
rJMFF026P14- TCCGCTGACTTAAATCCAAATGAAACTCTTGTTATTCCTTCATCAAATTCTTTGACAGTT
                      ____________________________________________________________
consensus TCCGCTGACTTAAATCCAAATGAAACTCTTGTTATTCCTTCATCAAATTCTTTGACAGTT
 
. : . : . : . : . : . :
rJMFF026P14- TTGGCATTAGCAGCTAATGGGATATTATATTCACCTCCAATATCTTCAAATAAAAGAGCA
                      ____________________________________________________________
consensus TTGGCATTAGCAGCTAATGGGATATTATATTCACCTCCAATATCTTCAAATAAAAGAGCA
 
. : . : . : . : . : . :
rJMFF026P14- TGCTTTTTGAAAATTTTGCAGAGAGCATTTGCTAGTGCTTTGTCATAAACAATGTTAAAG
                      ____________________________________________________________
consensus TGCTTTTTGAAAATTTTGCAGAGAGCATTTGCTAGTGCTTTGTCATAAACAATGTTAAAG