Previous Contig 009470:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026M12Sequence520001264 (3)pir|T50561|T505611e-22SINA1 protein [imported] - Vitis vinifera>gb:VVI18471_1727495 Vitis vinifera mRN754009470 (3)gb:AP003988_1835977e-105Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFF031P23Sequence555001264 (3)pir|T50561|T505614e-30SINA1 protein [imported] - Vitis vinifera>gb:VVI18471_1727495 Vitis vinifera mRN636009470 (3)gb:BT005507_16384472e-83Arabidopsis thaliana clone U50437 putative developmental protein SINA (seven in
JMSF007N18Sequence282001264 (3)781009470 (3)gb:AP003988_1835977e-117Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007N18+ CGGAGTCGCTTGAACTTCCCTGCAGATATTTTTC
                      ____________________________________________________________
consensus CGGAGTCGCTTGAACTTCCCTGCAGATATTTTTC
 
. : . : . : . : . : . :
rJMSF007N18+ ATTGGGGTGTCCAGAAATATTCCCATATTACAGCAAGCTTAAACATGAGACAATTTGCAA
rJMFF026M12+ ATTACAGCAAGCTTAAACATGAGACAATTTGCAA
                      ____________________________________________________________
consensus ATTGGGGTGTCCAGAAATATTCCCATATTACAGCAAGCTTAAACATGAGACAATTTGCAA
 
. : . : . : . : . : . :
rJMSF007N18+ TTTTAGACCATACAATTGCCCATACGCTGGATCAGAGTGTTCAGTTACCGGTGATATACC
rJMFF026M12+ TTTTAGACCATACAATTGCCCATACGCTGGATCAGAGTGTTCAGTTACCGGTGATATACC
                      ____________________________________________________________
consensus TTTTAGACCATACAATTGCCCATACGCTGGATCAGAGTGTTCAGTTACCGGTGATATACC
 
. : . : . : . : . : . :
rJMSF007N18+ TTACCTCGTTTCTCATTTGAGAGATGACCACAAGGTTGACATGCACACGGGATGCACATT
rJMFF031P23+ TGAGAGATGACCACAAGGTTGACATGCACACGGGATGCACATT
rJMFF026M12+ TTACCTCGTTTCTCATTTGAGAGATGACCACAAGGTTGACATGCACACGGGATGCACATT
                      ____________________________________________________________
consensus TTACCTCGTTTCTCATTTGAGAGATGACCACAAGGTTGACATGCACACGGGATGCACATT
 
. : . : . : . : . : . :
rJMSF007N18+ CAACCATCGATATGTCAAGTCTAATCCGCGGGAAGTCGAAAATGCCACATGGATGCTGAC
rJMFF031P23+ CAACCATCGATATGTCAAGTCTAATCCGCGGGAAGTCGAAAATGCCACATGGATGCTGAC
rJMFF026M12+ CAACCATCGATATGTCAAGTCTAATCCGCGGGAAGTCGAAAATGCCACATGGATGCTGAC
                      ____________________________________________________________
consensus CAACCATCGATATGTCAAGTCTAATCCGCGGGAAGTCGAAAATGCCACATGGATGCTGAC
 
. : . : . : . : . : . :
rJMSF007N18+ TGTCTTCCACTGTTTTGGTCAGTACTTCTGTCTTCACTTTGAGGCCTTCCAGCTCGGCAT
rJMFF031P23+ TGTCTTCCACTGTTTTGGTCAGTACTTCTGTCTTCACTTTGAGGCCTTCCAGCTCGGCAT
rJMFF026M12+ TGTCTTCCACTGTTTTGGTCAGTACTTCTGTCTTCACTTTGAGGCCTTCCAGCTCGGCAT
                      ____________________________________________________________
consensus TGTCTTCCACTGTTTTGGTCAGTACTTCTGTCTTCACTTTGAGGCCTTCCAGCTCGGCAT
 
. : . : . : . : . : . :
rJMSF007N18+ GGCACCTGTTTACATGGCTTTTGTCCGCTTCATGGGCGACGAGACTGAAGCCCGCAATTA
rJMFF031P23+ GGCACCTGTTTACATGGCTTTTGTCCGCTTCATGGGCGACGAGACTGAAGCCCGCAATTA
rJMFF026M12+ GGCACCTGTTTACATGGCTTTTGTCCGCTTCATGGGCGACGAGACTGAAGCCCGCAATTA
                      ____________________________________________________________
consensus GGCACCTGTTTACATGGCTTTTGTCCGCTTCATGGGCGACGAGACTGAAGCCCGCAATTA
 
. : . : . : . : . : . :
rJMSF007N18+ CAGCTACAGTCTTGAAGTAGGAGGAAGCGGTAGAAAGCTAATATGGGAAGGTACTCCAAG
rJMFF031P23+ CAGCTACAGTCTTGAAGTAGGAGGAAGCGGTAGAAAGCTAATATGGGAAGGTACTCCAAG
rJMFF026M12+ CAGCTACAGTCTTGAAGTAGGAGGAAGCGGTAGAAAGCTAATATGGGAAGGTACTCCAAG
                      ____________________________________________________________
consensus CAGCTACAGTCTTGAAGTAGGAGGAAGCGGTAGAAAGCTAATATGGGAAGGTACTCCAAG
 
. : . : . : . : . : . :
rJMSF007N18+ AAGTACCCGAGACAGCCACCGCAAGGTGAGGGACAGCCACGATGGCCTTATCATTCAACG
rJMFF031P23+ AAGTACCCGAGACAGCCACCGCAAGGTGAGGGACAGCCACGATGGCCTTATCATTCAACG
rJMFF026M12+ AAGTACCCGAGACAGCCACCGCAAGGTGAGGGACAGCCACGATGGCCTTATCATTCAACG
                      ____________________________________________________________
consensus AAGTACCCGAGACAGCCACCGCAAGGTGAGGGACAGCCACGATGGCCTTATCATTCAACG
 
. : . : . : . : . : . :
rJMSF007N18+ TAACATGGCACTGTTCTTCTCTGGTGGGGATAGGAAGGAACTGAAGCTTAGGGTCACCGG
rJMFF031P23+ TAACATGGCACTGTTCTTCTCTGGTGGGGATAGGAAGGAACTGAAGCTTAGGGTCACCGG
rJMFF026M12+ TAACATGGCACTGTTCTTCTCTGGTGGGGATAGGAAGGAACTGAAGCTTAGGGTCACCGG
                      ____________________________________________________________
consensus TAACATGGCACTGTTCTTCTCTGGTGGGGATAGGAAGGAACTGAAGCTTAGGGTCACCGG
 
. : . : . : . : . : . :
rJMSF007N18+ GAGGATATGGAAGGAGCAGCAAAACCCAGATTCTGGTGTTTGTATACCGAATATTTGTAG
rJMFF031P23+ GAGGATATGGAAGGAGCAGCAAAACCCAGATTCTGGTGTTTGTATACCGAATATTTGTAG
rJMFF026M12+ GAGGATATGGAAGGAGCAGCAAAACCCAGATTCTGGTGTTTGTATACCGAATATTTGTAG
                      ____________________________________________________________
consensus GAGGATATGGAAGGAGCAGCAAAACCCAGATTCTGGTGTTTGTATACCGAATATTTGTAG
 
. : . : . : . : . : . :
rJMSF007N18+ CAGTTAAGCTCCCCCTTCAGCCTTCGGGAGTGATATGATTCTCCTCCATGGATTTGTGGA
rJMFF031P23+ CAGTTAAGCTCCCCCTTCAGCCTTCGGGAGTGATATGATTCTCCTCCATGGATTTGTGGA
rJMFF026M12+ CAGTTAAGCTCCCCCTTCAGCCTTCGGGAGTGATATGATTCTCCTCCATGGATTTGTGGA
                      ____________________________________________________________
consensus CAGTTAAGCTCCCCCTTCAGCCTTCGGGAGTGATATGATTCTCCTCCATGGATTTGTGGA
 
. : . : . : . : . : . :
rJMSF007N18+ TTGCTTGTTGTGTGTGTGAGAGTGTGTGAGCCTCTTTGTGTTGTTAGTAAAGTTTGTGCT
rJMFF031P23+ TTGCTTGTTGTGTGTGTGAGAGTGTGTGAGCCTCTTTGTGTTGTTAGTAAAGTTTGTGCC
rJMFF026M12+ TTGCTTGTTGTGTGTGTGAGAGTGTGTGAGCCTCTTTGTGTTGTTAGTAAAGTTTGTGCC
                      ____________________________________________________________
consensus TTGCTTGTTGTGTGTGTGAGAGTGTGTGAGCCTCTTTGTGTTGTTAGTAAAGTTTGTGCC
 
. : . : . : . : . : . :
rJMSF007N18+ CTGTGAATGTATTAGGATGCTGCTGCA
rJMFF031P23+ CTGTGAATGTATTAGGATGCTGCTGCATTTTCGCCATGGATGAATATATAGAG
rJMFF026M12+ CTGTGAATGTATTAGGATGCTGCTGCATTTTCGCCATGGATGAATATATAGAGTTATCAA
                      ____________________________________________________________
consensus CTGTGAATGTATTAGGATGCTGCTGCATTTTCGCCATGGATGAATATATAGAGTTATCAA