Previous Contig 009460:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026K16Sequence467005668 (2)gb:AC103551_17372963e-26Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete sequence.658009460 (3)gb:BT003126_16367073e-34Arabidopsis thaliana At3g63470 mRNA, complete cds.
JMFN016L06Sequence486009460 (3)pir|D84631|D846311e-32probable serine carboxypeptidase II [imported] - Arabidopsis thaliana>gb:AC00517
JMSF017D02Sequence421005668 (2)gb:AC103551_17372964e-13Oryza sativa chromosome 3 BAC OSJNBb0058G04 genomic sequence, complete sequence.726009460 (3)gb:BT003126_16367071e-42Arabidopsis thaliana At3g63470 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016L06- TGGGGAATGTGTATTAGTAT
rJMSF017D02+ AATGTGTATTTGTAT
                      ____________________________________________________________
consensus TGGGGAATGTGTATTTGTAT
 
. : . : . : . : . : . :
JMFN016L06- GATATCTACGCGCCGTTATGACATTCTGACTCTCCCTCGTACCATATTCCAGGATTCGAT
rJMSF017D02+ GATATCTACGCGCCGTTATGTCATTCTGACTCTCCCTCGTTTCATATTTCAGGATTTGAT
                      ____________________________________________________________
consensus GATATCTACGCGCCGTTATGTCATTCTGACTCTCCCTCGTTTCATATTTCAGGATTTGAT
 
. : . : . : . : . : . :
JMFN016L06- CCCTGCACTGAAGACTACATCCATGCCTACCTCAACAATCTTGAAGTTCAGACTGCCCTT
rJMSF017D02+ CCCTGCACTGAAGACTACATCCATGCCTACCTCAACAATCTTCAAGTCCAGACTGCCCTT
rJMFF026K16+ CCTGCACTGAAGACTACATCCATGCCTACCTCAACAATCTTCAAGTCCAGACTGCCCTT
                      ____________________________________________________________
consensus CCCTGCACTGAAGACTACATCCATGCCTACCTCAACAATCTTCAAGTCCAGACTGCCCTT
 
. : . : . : . : . : . :
JMFN016L06- CATGCACATATTACCGCCACTCCCCATCCATGGAATAAACCAAATGACAGACTAAATATC
rJMSF017D02+ CATGCAAATATTACCGCCACTCCCCATCCATGGAATAAACGAAATGACAGACTAAATAGC
rJMFF026K16+ CATGCAAATATTACCGCCACTCCCCATCCATGGAATAAACGAAATGACAGACTAAATAGC
                      ____________________________________________________________
consensus CATGCAAATATTACCGCCACTCCCCATCCATGGAATAAACGAAATGACAGACTAAATAGC
 
. : . : . : . : . : . :
JMFN016L06- GATTGGAAAATGCCGGCGACTGTATTGCCCATTGGGAAAGAATTGATGCATACTGGTATC
rJMSF017D02+ GATTGGAAAATGCCGGCGACTGTATTGCCCATTGTGAAAGAATTGATGCAAAGTGGTATC
rJMFF026K16+ GATTGGAAAATGCCGGCGACTGTATTGCCCATTGTGAAAGAATTGATGCAAAGTGGTATC
                      ____________________________________________________________
consensus GATTGGAAAATGCCGGCGACTGTATTGCCCATTGTGAAAGAATTGATGCAAAGTGGTATC
 
. : . : . : . : . : . :
JMFN016L06- CGTTTGTGGATATATAGCGGTGATACGGATAGTATAATGCCATTGCCGGACACTAAACGT
rJMSF017D02+ CGTTTCTGGATATATAGTGGAGATACGGATAGTATAATGCCATTGTCGGACACTAGACGT
rJMFF026K16+ CGTTTCTGGATATATAGTGGAGATACGGATAGTATAATGCCATTGTCGGACACTAGACGT
                      ____________________________________________________________
consensus CGTTTCTGGATATATAGTGGAGATACGGATAGTATAATGCCATTGTCGGACACTAGACGT
 
. : . : . : . : . : . :
JMFN016L06- TCCATAAACAAACTCGAGCCATCGGGTAAAACTTCCTGGTACCCATGGTATCTTCAAAGA
rJMSF017D02+ TCCATAAAGAAACTCGAGCCATCGGTTAAAACTTCCTGGTACCCATGGTATCTCCGAGGA
rJMFF026K16+ TCCATAAAGAAACTCGAGCCATCGGTTAAAACTTCCTGGTACCCATGGTATCTCCGAGGA
                      ____________________________________________________________
consensus TCCATAAAGAAACTCGAGCCATCGGTTAAAACTTCCTGGTACCCATGGTATCTCCGAGGA
 
. : . : . : . : . : . :
JMFN016L06- TAGGCGGGTGGATCTGCAGTGGAATATGAGAACTTGACATTAATAACAGTAACAGGATCT
rJMSF017D02+ GAGGTGGGTGGATATGCAGTGGAGTATGAGAACTTGACATTAGTAACAGTAAGAGGATCT
rJMFF026K16+ GAGGTGGGTGGATATGCAGTGGAGTATGAGAACTTGACATTAGTAACAGTAAGAGGATCT
                      ____________________________________________________________
consensus GAGGTGGGTGGATATGCAGTGGAGTATGAGAACTTGACATTAGTAACAGTAAGAGGATCT
 
. : . : . : . : . : . :
JMFN016L06- GGGCATTTTGTTCCTAGCTACCAGCCAGCTGGAGCACTTGTACTCT
rJMSF017D02+ GGGCATTTTGTTCCTAGTTACCAGCCAGCTCGTGCACTTGTACTCTTCACCTCATTCATC
rJMFF026K16+ GGGCATTTTGTTCCTAGTTA-CAGCCAGCTCGTGCACTTGTACTCTTCACCTCATTCATC
                      ____________________________________________________________
consensus GGGCATTTTGTTCCTAGTTACCAGCCAGCTCGTGCACTTGTACTCTTCACCTCATTCATC
 
. : . : . : . : . : . :
rJMSF017D02+ AATGGACAACTCCCACCCCGACACCTAAACACAGTGCAACCACCCGACATGAATCTCCTC
rJMFF026K16+ AATGGACAACTCCCACCCCGACACCTAAACACAGTGCAACCACCCGACATGAATCTCCTC
                      ____________________________________________________________
consensus AATGGACAACTCCCACCCCGACACCTAAACACAGTGCAACCACCCGACATGAATCTCCTC
 
. : . : . : . : . : . :
rJMSF017D02+ CGATCCTCTCAGGACAACAACAGAAGAACAAAACATCGGACTAAAACAATATAAACTCCA
rJMFF026K16+ CGATCCTCTCAGGACAACAACAGAAGAACAAAACATCGGACTAAAACAATATAAACTCCA
                      ____________________________________________________________
consensus CGATCCTCTCAGGACAACAACAGAAGAACAAAACATCGGACTAAAACAATATAAACTCCA
 
. : . : . : . : . : . :
rJMSF017D02+ TGGTCAGAGGATTATATATATTGCAAGAAACAGCAAATTAAGTGCACAGGAAGTACAACG
rJMFF026K16+ TGGTCAGAGGATTATATATATTGCAAGAAACAGCAAATTAAGTGCACAGGAAGTACAACG
                      ____________________________________________________________
consensus TGGTCAGAGGATTATATATATTGCAAGAAACAGCAAATTAAGTGCACAGGAAGTACAACG
 
. : . : . : . : . : . :
rJMSF017D02+ AAATCAGCCTATTATTATAAATAAATCAAGATTGTTGTAACAATTCTGAGT
rJMFF026K16+ AAATCAGCCTATTATTATAAATAAATCAAGATTGTTGTAACAATTCTGAGTTTACCAATG
                      ____________________________________________________________
consensus AAATCAGCCTATTATTATAAATAAATCAAGATTGTTGTAACAATTCTGAGTTTACCAATG