Previous Contig 009459:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005K16Sequence492001111 (11)pir|A59200|A592002e-75acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:738009459 (16)pir|A59200|A59200e-116acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF012M01Sequence507001111 (11)pir|A59200|A592001e-77acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:704009459 (16)pir|A59200|A592003e-97acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF018H21Sequence567001111 (11)pir|A59200|A592007e-91acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:769009459 (16)pir|A59200|A59200e-108acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF018L10Sequence564001111 (11)pir|A59200|A592001e-91acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:737009459 (16)pir|A59200|A592003e-96acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF022E09Sequence533001111 (11)pir|A59200|A592007e-76acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:792009459 (16)pir|A59200|A59200e-114acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF026K08Sequence681009459 (16)pir|A59200|A592002e-53acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF029D22Sequence758009459 (16)pir|A59200|A59200e-106acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF029I20Sequence771009459 (16)pir|A59200|A59200e-108acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF036M08Sequence589001111 (11)pir|A59200|A592003e-96acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:702009459 (16)pir|A59200|A592006e-96acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF044O18Sequence631001111 (11)pir|A59200|A59200e-102acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:604009459 (16)pir|A59200|A592001e-64acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF045L09Sequence641001111 (11)pir|A59200|A59200e-103acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:566009459 (16)pir|A59200|A592001e-64acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFF048B02Sequence428001111 (11)pir|A59200|A592009e-61acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:405009459 (16)pir|A59200|A592005e-24acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFN008J06Sequence618009459 (16)pir|A59200|A59200e-115acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFN043F12Sequence599009459 (16)pir|A59200|A59200e-113acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFS149D05Sequence503009459 (16)pir|A59200|A592003e-53acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:
JMFS161H07Sequence577009459 (16)pir|A59200|A592005e-70acid phosphatase (EC 3.1.3.2) purple 1, precursor [validated] - sweet potato>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN008J06- CCCGGCAAAAGGACAGGCAG
                      ____________________________________________________________
consensus CCCGGCAAAAGGACAGGCAG
 
. : . : . : . : . : . :
JMFN008J06- TGTTGTTCGTTGGAGACCTCTCGTATGCAGATAGGTGGCCGAATCATGACAACAACCGGT
                      ____________________________________________________________
consensus TGTTGTTCGTTGGAGACCTCTCGTATGCAGATAGGTGGCCGAATCATGACAACAACCGGT
 
. : . : . : . : . : . :
JMFN008J06- GGGATACGTGGGGAAGGTTTTCAGAGCGAAGCGCTGCGTATCAGCCTTGGATTTGGACTG
JMFN043F12- ATCAGCCTTGGATTTGGACTG
                      ____________________________________________________________
consensus GGGATACGTGGGGAAGGTTTTCAGAGCGAAGCGCTGCGTATCAGCCTTGGATTTGGACTG
 
. : . : . : . : . : . :
JMFN008J06- CAGGAAATCACGAGATTGATTATGCTCCTGAAATTGGTGAGTACCAACCATTCATACCTT
JMFN043F12- CAGGAAATCACGAGATTGATTATGCTCCTGAAATTGGTGAGTACCAACCATTCATACCTT
                      ____________________________________________________________
consensus CAGGAAATCACGAGATTGATTATGCTCCTGAAATTGGTGAGTACCAACCATTCATACCTT
 
. : . : . : . : . : . :
JMFN008J06- TTACAAAACGGTATCCTACACCACACGAAGCATCGGGGAGCGGTGATCCACTTTGGTACT
JMFN043F12- TTACAAAACGGTATCCTACACCACACGAAGCATCGGGGAGCGGTGATCCACTTTGGTACT
rJMFF005K16+ CGAAGCATCGGGGAGCGGTGATCCACTTTGGTACT
rJMFF022E09+ GGGAGCGGTGATCCACTTTGGTACT
rJMFF029I20+ T
rJMFF018H21+ T
                      ____________________________________________________________
consensus TTACAAAACGGTATCCTACACCACACGAAGCATCGGGGAGCGGTGATCCACTTTGGTACT
 
. : . : . : . : . : . :
JMFN008J06- CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
JMFN043F12- CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
rJMFF005K16+ CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
rJMFF022E09+ CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
rJMFF029I20+ CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
rJMFF018H21+ CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
rJMFF029D22+ CTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
rJMFF018L10+ TACTCGGGCTTCGCTAAAT
                      ____________________________________________________________
consensus CCATAAAACGAGCTTCTGCACATATCATTGTCCTGTCTTCTTACTCGGGCTTCGCTAAAT
 
. : . : . : . : . : . :
JMFN008J06- ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
JMFN043F12- ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF005K16+ ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF022E09+ ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGATACGC
rJMFF029I20+ ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF018H21+ ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF036M08+ ACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF012M01+ CCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF029D22+ ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
rJMFF018L10+ ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
                      ____________________________________________________________
consensus ACTCTCCACAGTATAAATGGTTTACGAGTGAACTACAAAAAGTTAACAGGAGCGAGACGC
 
. : . : . : . : . : . :
JMFN008J06- CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
JMFN043F12- CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF005K16+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF022E09+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF029I20+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF018H21+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF036M08+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF012M01+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF029D22+ CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
rJMFF018L10+ CTTGGCTCATTGTGCTGGTGCACCGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
                      ____________________________________________________________
consensus CTTGGCTCATTGTGCTGGTGCA-CGCTCCATTATACAATAGCTATGAAGCTCACTACTTG
 
. : . : . : . : . : . :
JMFN008J06- GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
JMFN043F12- GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF005K16+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF022E09+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF029I20+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF018H21+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF036M08+ GAAGGGGAAGGCATGCGTGCGATATTTAAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF012M01+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF029D22+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
JMFS161H07- CGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF018L10+ GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
rJMFF045L09+ TACAAAGTGGATGTC
rJMFF044O18+ TACAAAGTGGATGTC
                      ____________________________________________________________
consensus GAAGGGGAAGGCATGCGTGCGATATTTGAGCCCTATTTCGTCTATTACAAAGTGGATGTC
 
. : . : . : . : . : . :
JMFN008J06- GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
JMFN043F12- GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF005K16+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF022E09+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF029I20+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF018H21+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF036M08+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF012M01+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF029D22+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
JMFS161H07- GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF018L10+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF045L09+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
rJMFF044O18+ GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
JMFS149D05- CGTATCGAATGTTGCATAC
rJMFF026K08+ CGCGTATCGAATGTTGCATAC
                      ____________________________________________________________
consensus GTGTTTTCTGGACATGTTCACTCCTACGAACGATCTGAACGCGTATCGAATGTTGCATAC
 
. : . : . : . : . : . :
JMFN008J06- AACATTGTGAATGCAAAGNTCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTAC
JMFN043F12- AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF005K16+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF022E09+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF029I20+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF018H21+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF036M08+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF012M01+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF029D22+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
JMFS161H07- AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF018L10+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF045L09+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF044O18+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
JMFS149D05- AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
rJMFF026K08+ AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
                      ____________________________________________________________
consensus AACATTGTGAATGCAAAGTGCACGCCTGTGAGGGATGAATCAGCCCCGGTTTACATTACC
 
. : . : . : . : . : . :
JMFN043F12- ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF005K16+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF022E09+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF029I20+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF018H21+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF036M08+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF012M01+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF029D22+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
JMFS161H07- ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF018L10+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF045L09+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF044O18+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
JMFS149D05- ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
rJMFF026K08+ ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
                      ____________________________________________________________
consensus ATAGGCGACGGGGGAAATTCAGAAGGATTAGCCTCGGAGATGACACAGCCACAGCCAAGC
 
. : . : . : . : . : . :
JMFN043F12- TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATA
rJMFF005K16+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF022E09+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF029I20+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF018H21+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF036M08+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF012M01+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF029D22+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
JMFS161H07- TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF018L10+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF045L09+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF044O18+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
JMFS149D05- TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF048B02+ TTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
rJMFF026K08+ TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
                      ____________________________________________________________
consensus TACTCTGCGTTTCGCGAGGCGAGCTTTGGGCATGGCATATTCGACATAAAGAACAGAACC
 
. : . : . : . : . : . :
rJMFF005K16+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF022E09+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF029I20+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF018H21+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF036M08+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF012M01+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF029D22+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
JMFS161H07- CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF018L10+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF045L09+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF044O18+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
JMFS149D05- CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
rJMFF048B02+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCTTCGGTTGAGGCTGATTCCGTG
rJMFF026K08+ CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
                      ____________________________________________________________
consensus CATGCCTATTTCTCGTGGCATCGCAACCAAGATGGGGCCTCGGTTGAGGCTGATTCCGTG
 
. : . : . : . : . : . :
rJMFF005K16+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF022E09+ TGGCTTCTTAACCGGTACTGGGCGTCCGAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF029I20+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF018H21+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF036M08+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF012M01+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF029D22+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
JMFS161H07- TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF018L10+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF045L09+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF044O18+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
JMFS149D05- TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF048B02+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
rJMFF026K08+ TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
                      ____________________________________________________________
consensus TGGCTTCTTAACCGGTACTGGGCGTCCAAGGATGCATCATCTGTGTCTGCAATGTGAAAC
 
. : . : . : . : . : . :
rJMFF005K16+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF022E09+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF029I20+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF018H21+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF036M08+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF012M01+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF029D22+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
JMFS161H07- CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF018L10+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF045L09+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF044O18+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
JMFS149D05- CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF048B02+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
rJMFF026K08+ CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
                      ____________________________________________________________
consensus CATTCATGAACTTTGATGTTGTTTGTGTTGGTTAATGTATGTATGGTTCTTGTTGGTTGG
 
. : . : . : . : . : . :
rJMFF005K16+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTG
rJMFF022E09+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF029I20+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF018H21+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF036M08+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF012M01+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF029D22+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
JMFS161H07- TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF018L10+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF045L09+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF044O18+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
JMFS149D05- TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF048B02+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
rJMFF026K08+ TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
                      ____________________________________________________________
consensus TTGGTTGTATTGATCTTCTTCTGTAGCTCTGTGGAGAAGCTTTGTGTTCCATTAGAGAAT
 
. : . : . : . : . : . :
rJMFF022E09+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAA
rJMFF029I20+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATA
rJMFF018H21+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAAC
rJMFF036M08+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACT
rJMFF012M01+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACT
rJMFF029D22+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACT
JMFS161H07- AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAAT
rJMFF018L10+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTA
rJMFF045L09+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTATG
rJMFF044O18+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTATG
JMFS149D05- AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTATG
rJMFF048B02+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTATG
rJMFF026K08+ AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTATG
                      ____________________________________________________________
consensus AAAGGGATCTTAGCAACTGCTGTAGAATCTGTAGTTCCTATTAATAAACTTGCAATTATG
 
. : . : . : . : . : . :
rJMFF045L09+ TATTATT
rJMFF044O18+ TATTATT
JMFS149D05- TATT
rJMFF048B02+ TATTATT
rJMFF026K08+ TATTATTACACAATTTGTAACTAACAACAATAACTATCATGTCTTGGGGTGATCTGGGTG
                      ____________________________________________________________
consensus TATTATTACACAATTTGTAACTAACAACAATAACTATCATGTCTTGGGGTGATCTGGGTG
 
. : . : . : . : . : . :
rJMFF026K08+ GAGTATGATTCTCATACCAAAAAGGGAAAAAGTCATGAGTACAATTCTTACCAAAACCTT
                      ____________________________________________________________
consensus GAGTATGATTCTCATACCAAAAAGGGAAAAAGTCATGAGTACAATTCTTACCAAAACCTT
 
. : . : . : . : . : . :
rJMFF026K08+ ATTAATCGAGTCCGTCTTGAATTGCGGGCTATTACACGTGGAGTTTACTAGTGCACACTT
                      ____________________________________________________________
consensus ATTAATCGAGTCCGTCTTGAATTGCGGGCTATTACACGTGGAGTTTACTAGTGCACACTT