Previous Contig 009458:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006H22Sequence514001085 (10)pir|T51181|T511813e-83actin 1 [imported] - small naked oat>gb:AF234528_1779534 Avena nuda actin 1 gene106009458 (4)
JMFF012L03Sequence216009458 (4)
JMFF026K01Sequence185001085 (10)168009458 (4)
JMFF049C11Sequence467001085 (10)gb:BT004315_16373903e-70Arabidopsis thaliana clone RAFL15-43-N11 (R50155) putative actin 4 (At5g59370) m402009458 (4)gb:AF386514_17947104e-06Pyrus communis actin mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF049C11+ CAGATGTGGATAGCAAAGGCTGAGTATGATGA
                      ____________________________________________________________
consensus CAGATGTGGATAGCAAAGGCTGAGTATGATGA
 
. : . : . : . : . : . :
rJMFF049C11+ GTCTGGCCCGTCGATTGTCCACAGAAAATGCTTCTAAGTGCAGCATGCTGGGAACGTCGC
                      ____________________________________________________________
consensus GTCTGGCCCGTCGATTGTCCACAGAAAATGCTTCTAAGTGCAGCATGCTGGGAACGTCGC
 
. : . : . : . : . : . :
rJMFF049C11+ TAGAGAATTGTTATAAAAAACATTTTGTCATCAGTTGATTGCCAATATCTCTGGTTCTTG
                      ____________________________________________________________
consensus TAGAGAATTGTTATAAAAAACATTTTGTCATCAGTTGATTGCCAATATCTCTGGTTCTTG
 
. : . : . : . : . : . :
rJMFF049C11+ CTTGTTTTGCTTTGGTTTTTACTTCTATTTTTATTTTTGGTTTTCTTTTTACTTGTTACT
                      ____________________________________________________________
consensus CTTGTTTTGCTTTGGTTTTTACTTCTATTTTTATTTTTGGTTTTCTTTTTACTTGTTACT
 
. : . : . : . : . : . :
rJMFF006H22+ CTC
rJMFF049C11+ CTGGCGCTTTATGTTGGGTTTTTTTTTTATTTATTTTTGXXXXXXXXXXXXXXXXXXCTC
                      ____________________________________________________________
consensus CTGGCGCTTTATGTTGGGTTTTTTTTTTATTTATTTTTGNNNNNNNNNNNNNNNNNNCTC
 
. : . : . : . : . : . :
rJMFF012L03+ TGAGATTTTCATTTGATAAGGTGGACTTGGGACCATGTTTGTTCATGCCAAGGATT
rJMFF006H22+ TTTTTGAGATTTTCATTTGATAAGGTGGACTTGGGACCATGTTTGTTCATGCCAAGGATT
rJMFF049C11+ TTTTTGAGATTTTCATTTGATAAGGTGGACTTGGGACCATGTTTGTTCATGCCAAGGATT
rJMFF026K01- TTTGATAANGTGGACTTGGGACCATGTTTGTTCATGCCAAGGATT
                      ____________________________________________________________
consensus TTTTTGAGATTTTCATTTGATAAGGTGGACTTGGGACCATGTTTGTTCATGCCAAGGATT
 
. : . : . : . : . : . :
rJMFF012L03+ CATTGAATCATTGTTATTATTATTATT
rJMFF006H22+ CA
rJMFF049C11+ CATTGAATCATTGTTATTATTATTATT
rJMFF026K01- CATTGAATCATTGTTATTATTATTATTAGTATTATTCTAAATTGGTTACCATGTAGAAGA
                      ____________________________________________________________
consensus CATTGAATCATTGTTATTATTATTATTAGTATTATTCTAAATTGGTTACCATGTAGAAGA
 
. : . : . : . : . : . :
rJMFF026K01- AGATTTGTGAATTTCAATGATACTATTATTTGTGATTTTGGACCAAAAAAAAAAAAANTC
                      ____________________________________________________________
consensus AGATTTGTGAATTTCAATGATACTATTATTTGTGATTTTGGACCAAAAAAAAAAAAANTC