Previous Contig 009455:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024F14Sequence463002922 (9)gb:AC005724_15329535e-33Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.531009455 (7)pir|T03793|T037931e-12calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFF026J03Sequence575002922 (9)gb:AC005724_15329532e-67Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.724009455 (7)pir|T03793|T037933e-39calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFF032B02Sequence524002922 (9)gb:AC005724_15329539e-59Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.719009455 (7)pir|T03793|T037936e-39calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFN020M14Sequence568009455 (7)pir|T03793|T037937e-64calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMFS033F04Sequence620009455 (7)pir|T03793|T037933e-65calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMSF022H18Sequence652002922 (9)gb:AC005724_15329536e-82Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.744009455 (7)pir|T03793|T037932e-42calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana
JMSF041I17Sequence825002922 (9)gb:AC005724_15329537e-93Arabidopsis thaliana chromosome 2 clone MSF3 map CIC06E08, complete sequence.632009455 (7)pir|T03793|T037933e-28calmodulin-binding protein TCB60 - common tobacco>gb:NTU58971_1691845 Nicotiana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS033F04- AAGGTATATGTTGATTCCTTGGTGAAGA
                      ____________________________________________________________
consensus AAGGTATATGTTGATTCCTTGGTGAAGA
 
. : . : . : . : . : . :
JMFS033F04- AAGCATATGAGAATTGGCTATCTGAAAGGGAGTATGATGGCAAAACACTTTTGAGCTTCA
                      ____________________________________________________________
consensus AAGCATATGAGAATTGGCTATCTGAAAGGGAGTATGATGGCAAAACACTTTTGAGCTTCA
 
. : . : . : . : . : . :
JMFS033F04- AAAATAAAAAAGCAAGAAATGAGCTTCCTATGGGCCAAGTGGACTATTCAAATTCTTTGA
                      ____________________________________________________________
consensus AAAATAAAAAAGCAAGAAATGAGCTTCCTATGGGCCAAGTGGACTATTCAAATTCTTTGA
 
. : . : . : . : . : . :
JMFS033F04- ATAATCAGCTTCAACAACCACGGCTTCCTGCTCCAGTCCAAAGTGAGCCATCTGCTTTGG
JMFN020M14- TCCAGTCCAAAGTGAGCCATCTGCTTTGG
                      ____________________________________________________________
consensus ATAATCAGCTTCAACAACCACGGCTTCCTGCTCCAGTCCAAAGTGAGCCATCTGCTTTGG
 
. : . : . : . : . : . :
JMFS033F04- ACCCTGGCATGCTAATTGGAGGTTCAAGTTATAATGAAAATATGGGTGCTAGGTACTCCA
JMFN020M14- ACCCTGGCATGCTAATTGGAGGTTCAAGTTATAATGAAAATATGGGTGCTAGGTACTCCA
                      ____________________________________________________________
consensus ACCCTGGCATGCTAATTGGAGGTTCAAGTTATAATGAAAATATGGGTGCTAGGTACTCCA
 
. : . : . : . : . : . :
JMFS033F04- ATCAGTCCCACATTATGAGCTCTAGTTCCCGGATGCAGTATGAAAACACTCAATTTGCTC
JMFN020M14- ATCAGTCCCACATTATGAGCTCTAGTTCCCGGATGCAGTATGAAAACACTCAATTTGCTC
                      ____________________________________________________________
consensus ATCAGTCCCACATTATGAGCTCTAGTTCCCGGATGCAGTATGAAAACACTCAATTTGCTC
 
. : . : . : . : . : . :
JMFS033F04- CAAATGATCAGCAGCAGCTAATGAACAACTCTCAGCAGATGCAAAATGCACGGTATGATA
JMFN020M14- CAAATGATCAGCAGCAGCTAATGAACAACTCTCAGCAGATGCAAAATGCACGGTATGATA
                      ____________________________________________________________
consensus CAAATGATCAGCAGCAGCTAATGAACAACTCTCAGCAGATGCAAAATGCACGGTATGATA
 
. : . : . : . : . : . :
JMFS033F04- ACAATGTTGGCCTGGCTCTTGGTCCTCCTCAATCTTCATGCTTCCCAACAGTAGGCTCAT
JMFN020M14- ACAATGTTGGCCTGGCTCTTGGTCCTCCTCAATCTTCATGCTTCCCAACAGTAGGCTCAT
                      ____________________________________________________________
consensus ACAATGTTGGCCTGGCTCTTGGTCCTCCTCAATCTTCATGCTTCCCAACAGTAGGCTCAT
 
. : . : . : . : . : . :
JMFS033F04- CTGTTCAGCAAACCAATCTCAATTCTTTTGAGGACTGGTCTAACACCCGTGACAAGGGGG
JMFN020M14- CTGTTCAGCAAACCAATCTCAATTCTTTTGAGGACTGGTCTAACACCCGTGACAAGGGGG
rJMFF032B02+ AAGGGGG
rJMSF022H18+ AGGACTGGTCTAACACCCGTGACAAGGGGG
rJMFF026J03+ AAGGGGG
                      ____________________________________________________________
consensus CTGTTCAGCAAACCAATCTCAATTCTTTTGAGGACTGGTCTAACACCCGTGACAAGGGGG
 
. : . : . : . : . : . :
JMFS033F04- TTGAGGAATATTTGTCTGAGGAGGAGATTCGTCTCAGAAGCCATGAAATGCTATAGAATG
JMFN020M14- TTGAGGAATATTTGTCTGAGGAGGAGATTCGTCTCAGAAGCCATGAAATGCTAGAGAATG
rJMSF041I17+ ATG
rJMFF032B02+ TTGAGGAATATTTGTCTGAGGAGGAGATTCGTNTCAGAAGCCATGAAATGCTAGAGAATG
rJMSF022H18+ TTGAGGAATATTTGTCTGAGGAGGAGATTCGTCTCAGAAGCCATGAAATGCTAGAGAATG
rJMFF026J03+ TTGAGGAATATTTGTCTGAGGAGGAGATTCGTCTCAGAAGCCATGAAATGCTAGAGAATG
                      ____________________________________________________________
consensus TTGAGGAATATTTGTCTGAGGAGGAGATTCGTCTCAGAAGCCATGAAATGCTAGAGAATG
 
. : . : . : . : . : . :
JMFS033F04- AAGATATGCAGCACTTGCTTCAGCTCTTCAGCATGGGAGGTCATGCGTCAGT
JMFN020M14- AAGATATGCAGCACTTGCTTCGGCTCTTCAGCATGGGAGGTCATGCGTCAGTAAATATTC
rJMSF041I17+ AAGATATGCAGCACTTGCTTCGGCTCTTCAGCATGGGAGGTCATGCGTCAGTAAATATTC
rJMFF032B02+ AAGATATGCAGCACTTGCTTCGGCTCTTCAGCATGGGAGGTCATGCGTCAGTAAATATTC
rJMSF022H18+ AAGATATGCAGCACTTGCTTCGGCTCTTCAGCATGGGAGGTCATGCGTCAGTAAATATTC
rJMFF026J03+ AAGATATGCAGCACTTGCTTCGGCTCTTCAGCATGGGAGGTCATGCGTCAGTAAATATTC
                      ____________________________________________________________
consensus AAGATATGCAGCACTTGCTTCGGCTCTTCAGCATGGGAGGTCATGCGTCAGTAAATATTC
 
. : . : . : . : . : . :
JMFN020M14- CGGAAGATGGATTTGGCTTCACCCCTTTCATGGCACCATCTCCAAGCTTCGGTTACGATG
rJMSF041I17+ CGGAAGATGGATTTGGCTTCACCCCTTTCATGGCACCATCTCCAAGCTTCGGTTACGATG
rJMFF032B02+ CGGAAGATGGATTTGGCTTCACCCCTTTCATGGCACCATCTCCAAGCTTCGGTTACGATG
rJMSF022H18+ CGGAAGATGGATTTGGCTTCACCCCTTTCATGGCACCATCTCCAAGCTTCGGTTACGATG
rJMFF026J03+ CGGAAGATGGATTTGGCTTCACCCCTTTCATGGCACCATCTCCAAGCTTCGGTTACGATG
                      ____________________________________________________________
consensus CGGAAGATGGATTTGGCTTCACCCCTTTCATGGCACCATCTCCAAGCTTCGGTTACGATG
 
. : . : . : . : . : . :
JMFN020M14- AGGACCGCCCTCGCCCAGGAAAAGCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATG
rJMSF041I17+ AGGACCGCCCTCGCCCAGGAAAAGCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATGC
rJMFF032B02+ AGGACCGCCCTCGCCCAGGAAAAGCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATGC
rJMSF022H18+ AGGACCGCCCTCGCCCAGGAAAAGCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATGC
rJMFF024F14+ CCGCCCTCGCCCAGGAAAANCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATGC
rJMFF026J03+ AGGACCGCCCTCGCCCAGGAAAAGCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATGC
                      ____________________________________________________________
consensus AGGACCGCCCTCGCCCAGGAAAAGCTGTTGTTGGTTGGCTGAAAATAAAAGCTGCAATGC
 
. : . : . : . : . : . :
rJMSF041I17+ GGTGGGGGTTCTTTATCAGGAAGAAGGCAGCCGAGAGGAGAGCCCAACTTGTAGAATTGG
rJMFF032B02+ GGTGGGGGTTCTTTATCAGGAAGAAGGCAGCCGAGAGGAGAGCCCAACTTGTAGAATTGG
rJMSF022H18+ GGTGGGGGTTCTTTATCAGGAAGAAGGCAGCCGAGAGGAGAGCCCAACTTGTAGAATTGG
rJMFF024F14+ GGTGGGGGTTCTTTATCAGGAAGAAGGCAGCCGAGAGGAGAGCCCAACTTGTAGAATTGG
rJMFF026J03+ GGTGGGGGTTCTTTATCAGGAAGAAGGCAGCCGAGAGGAGAGCCCAACTTGTAGAATTGG
                      ____________________________________________________________
consensus GGTGGGGGTTCTTTATCAGGAAGAAGGCAGCCGAGAGGAGAGCCCAACTTGTAGAATTGG
 
. : . : . : . : . : . :
rJMSF041I17+ ATGACGAGTAGAATTTGTTGTGAAGATTTTAGGGCATTGAGAGTTAACCACTCACCAGTT
rJMFF032B02+ ATGACGAGTAGAATTTGTTGTGAAGATTTTAGGGCATTGAGAGTTAACCACTCACCAGTT
rJMSF022H18+ ATGACGAGTAGAATTTGTTGTGAAGATTTTAGGGCATTGAGAGTTAACCACTCACCAGTT
rJMFF024F14+ ANGACGAGTAGAATTTGTTGTGAAGATTTTAGGGCATTGAGAGTTAACCACTCACCAGTT
rJMFF026J03+ ATGACGAGTAGAATTTGTTGTGAAGATTTTAGGGCATTGAGAGTTAACCACTCACCAGTT
                      ____________________________________________________________
consensus ATGACGAGTAGAATTTGTTGTGAAGATTTTAGGGCATTGAGAGTTAACCACTCACCAGTT
 
. : . : . : . : . : . :
rJMSF041I17+ GACGATTAATGCTGAAATCAATATCAATCTGAAAAGTAATGCAGCAGGACGAAGTAATTA
rJMFF032B02+ GACGATTAATGCTGAAATCAATATCAATCTGAAAAGTAATGCAGCAGGACGAAGTAATTA
rJMSF022H18+ GACGATTAATGCTGAAATCAATATCAATCTGAAAAGTAATGCAGCAGGACGAAGTAATTA
rJMFF024F14+ GACGATTAATGNTGAAATCAATATCAATCTGAAAAGTAATGCAGCAGGACGAAGTAATTA
rJMFF026J03+ GACGATTAATGCTGAAATCAATATCAATCTGAAAAGTAATGCAGCAGGACGAAGTAATTA
                      ____________________________________________________________
consensus GACGATTAATGCTGAAATCAATATCAATCTGAAAAGTAATGCAGCAGGACGAAGTAATTA
 
. : . : . : . : . : . :
rJMSF041I17+ GGGGTTTCAGGACTGCACACACAGGCTTAGTTTGCTATTGCTTGCTCGCTCACAAGTCTT
rJMFF032B02+ GGGGTTTCAGGACTGCACACACAGGCTTAGTTTGCTATTGCTTGCTCGCTCACAAGTCTT
rJMSF022H18+ GGGGTTTCAGGACTGCACACACAGGCTTAGTTTGCTATTGCTTGCTCGCTCACAAGTCTT
rJMFF024F14+ GGGGTTTCAGGACTGCACACACAGGCTTAGTTTGCTATTGCTTGCTCGCTCACAAGTCTT
rJMFF026J03+ GGGGTTTCAGGACTGCACACACAGGCTTAGTTTGCTATTGCTTGCTCGCTCACAAGTCTT
                      ____________________________________________________________
consensus GGGGTTTCAGGACTGCACACACAGGCTTAGTTTGCTATTGCTTGCTCGCTCACAAGTCTT
 
. : . : . : . : . : . :
rJMSF041I17+ GAATACCTCTCCTCCCATGTACAGAAAAGCCTGTACAGTAAGTAAGTTTATTCTCTTCTA
rJMFF032B02+ GAATACCTCTCCTCCCATGTACAGAAAAGCCTGTACAGTAAGTAAGTTTATTCTCTTCTA
rJMSF022H18+ GAATACCTCTCCTCCCATGTACAGAAAAGCCTGTACAGTAAGTAAGTTTATTCTCTTCTA
rJMFF024F14+ GAATNCCTCTCCTCCCATGTNCAGAAAAGCCTGTACAGTAAGTAAGTTTATTCTCTTNTA
rJMFF026J03+ GAATACCTCTCCTCCCATGTACAGAAAAGCCTGTACAGTAAGTAAGTTTATTCTCTTCTA
                      ____________________________________________________________
consensus GAATACCTCTCCTCCCATGTACAGAAAAGCCTGTACAGTAAGTAAGTTTATTCTCTTCTA
 
. : . : . : . : . : . :
rJMSF041I17+ TTGACATATTATAGACTGGGTTGCTGCTCACTGTATTCCTTTGTTTTCTTTTGTGAATTG
rJMFF032B02+ TTGACATATTATAGACTGGGTTGCTGCTCACTGTATTCCTTTGTTTTCTTTTGTGAATTG
rJMSF022H18+ TTGACATATTATAGACTGGGTTGCTGCCCACTGTATTCCTTTGTTTTCTTTTGTGAATTG
rJMFF024F14+ TTGACATATTATAGANTGGGTTGCTGCTCACTGTATTCCTTTGTTTTCTTTTGTGAATTG
rJMFF026J03+ TTGACATATTATAGACTGGGTTGCTGCTCACTGTATT---TTGTTTTCTTTTGTGAATTG
                      ____________________________________________________________
consensus TTGACATATTATAGACTGGGTTGCTGCTCACTGTATTCCTTTGTTTTCTTTTGTGAATTG
 
. : . : . : . : . : . :
rJMSF041I17+ TGATGTAATGTAATGTATTGCCACCCCAAATCCCCCAATGGATCATGCCCTTCNTATCTC
rJMFF032B02+ TGATGTAATGTAATGTATTGCCACCCCAAATCCCCCAATGGATCATGCCCTTCCTATCTC
rJMSF022H18+ TGATGTAATGTAATGTATTGCCACCCCAAATCCCCCAATGGATCATGCCCTTCCTATCTC
rJMFF024F14+ TGATGTAATGTAATGTATTGCCACCCCAAATCCCCCAATGGATCATGCCCTTCCTATCTC
rJMFF026J03+ TGATGTAATGTAATGTATTGCCACCCCAAATCCCCCAATGGATCATGCCCTTCCTATCTC
                      ____________________________________________________________
consensus TGATGTAATGTAATGTATTGCCACCCCAAATCCCCCAATGGATCATGCCCTTCCTATCTC
 
. : . : . : . : . : . :
rJMSF041I17+ TCTATTCATTACCCTTTAGTTCTGGATAT
rJMFF032B02+ TCTATTCATTACCCTTTAGTTCTGGATATTGAA-TGTAAAACTAAGTT
rJMSF022H18+ TCTATTCATTACCCTTTAGTTCTGGATATTGAATTGTAAAACTAAGTT
rJMFF024F14+ TCTATTCATTACCCNATAGTTCTGGATATTGAATTGTAAAACTAAGTT
rJMFF026J03+ TCTATTCATTACCCTTTAGTTCTGGATATTGAATTGTAAAACTAAGTTTCAACTATGATA
                      ____________________________________________________________
consensus TCTATTCATTACCCTTTAGTTCTGGATATTGAATTGTAAAACTAAGTTTCAACTATGATA