Previous Contig 009444:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026G15Sequence547008101 (2)pir|F84718|F847184e-17hypothetical protein At2g31270 [imported] - Arabidopsis thaliana>gb:AC006593_153745009444 (2)gb:AY131998_15813154e-34Arabidopsis thaliana hypothetical protein (At2g31270/F16D14.11) mRNA, complete c
JMSF038O13Sequence516007252 (3)813009444 (2)gb:AY131998_15813151e-36Arabidopsis thaliana hypothetical protein (At2g31270/F16D14.11) mRNA, complete c

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038O13+ CCAAGAGATGTTATATGACTCCAGAAGACGACGATTCAGCTAAATCT
                      ____________________________________________________________
consensus CCAAGAGATGTTATATGACTCCAGAAGACGACGATTCAGCTAAATCT
 
. : . : . : . : . : . :
rJMSF038O13+ CCAAACAAACTAGTTAGGCGCCCTTCCAGGGCGGTCAGGCAGATCTTTGACACTCCAGTG
rJMFF026G15+ CAGGCAGATCTTTGACACTCCAGTG
                      ____________________________________________________________
consensus CCAAACAAACTAGTTAGGCGCCCTTCCAGGGCGGTCAGGCAGATCTTTGACACTCCAGTG
 
. : . : . : . : . : . :
rJMSF038O13+ AAGAACGAAGGTAGTGAGACCGAAAGACTTTCAGCTCGTGATGATGTATATGATCTCCCC
rJMFF026G15+ AAGAACGAAGGTAGTGAGACCGAAAGACTTTCAGCTCGTGATGATGTATATGATCTCCCC
                      ____________________________________________________________
consensus AAGAACGAAGGTAGTGAGACCGAAAGACTTTCAGCTCGTGATGATGTATATGATCTCCCC
 
. : . : . : . : . : . :
rJMSF038O13+ GAGGATCTCCTGGAATCAATAAGAGAAAAGGAAAGGAAAGCGCTCGAGGAAAAAGATCCC
rJMFF026G15+ GAGGATCTCCTGGAATCAATAAGAGAAAAGGAAAGGAAAGCGCTCGAGGAAAAAGATCCC
                      ____________________________________________________________
consensus GAGGATCTCCTGGAATCAATAAGAGAAAAGGAAAGGAAAGCGCTCGAGGAAAAAGATCCC
 
. : . : . : . : . : . :
rJMSF038O13+ GCCATCTCACAAGCAAAATGGAGGAAACAAATGCTTGCAGGGCTACCGAAACTGTTTGAC
rJMFF026G15+ GCCATCTCACAAGCAAAATGGAGGAAACAAATGCTTGCAGGGCTACCGAAACTGTTTGAC
                      ____________________________________________________________
consensus GCCATCTCACAAGCAAAATGGAGGAAACAAATGCTTGCAGGGCTACCGAAACTGTTTGAC
 
. : . : . : . : . : . :
rJMSF038O13+ ACAATTTATTTCCTGTTTCAATCGATCAGACGCTCTGTCATCACCAAGGAGGAATTTATG
rJMFF026G15+ ACAATTTATTTCCTGTTTCAATCGATCAGACGCTCTGTCATCACCAAGGAGGAATTTATG
                      ____________________________________________________________
consensus ACAATTTATTTCCTGTTTCAATCGATCAGACGCTCTGTCATCACCAAGGAGGAATTTATG
 
. : . : . : . : . : . :
rJMSF038O13+ CACAAGATCGTTTCAAGCCACCTAGGAACTGTTGATACTAGAGAAATCGAAGAGCAACTC
rJMFF026G15+ CACAAGATCGTTTCAAGCCACCTAGGAACTGTTGATACTAGAGAAATCGAAGAGCAACTC
                      ____________________________________________________________
consensus CACAAGATCGTTTCAAGCCACCTAGGAACTGTTGATACTAGAGAAATCGAAGAGCAACTC
 
. : . : . : . : . : . :
rJMSF038O13+ AGATTACTGCATGAACTAGCGCCAGAATGGATCCATGAAAAGCCAGCATCAAGTGGCGAT
rJMFF026G15+ AGATTACTGCATGAACTAGCGCCAGAATGGATCCATGAAAAGCCAGCATCAAGTGGCGAT
                      ____________________________________________________________
consensus AGATTACTGCATGAACTAGCGCCAGAATGGATCCATGAAAAGCCAGCATCAAGTGGCGAT
 
. : . : . : . : . : . :
rJMSF038O13+ CTCCTCATATGTGTTAACAAGATCCCGGGCCCTGAATCAATACGCTTGAGACTTGCAGAT
rJMFF026G15+ CTCCTCATATGTGTTAACAAGATCCCGGGCCCTGAATCAATACGCTTGAGACTTGCAGAT
                      ____________________________________________________________
consensus CTCCTCATATGTGTTAACAAGATCCCGGGCCCTGAATCAATACGCTTGAGACTTGCAGAT
 
. : . : . : . : . : . :
rJMSF038O13+ GCAAAGTGAAATCGGGGAGGATGAAGTAACAGTTGTAGATAATCTTGTTTGAGGCTTATT
rJMFF026G15+ GCAAAGTGAAATCGGGGAGGGTGAAGTAACAGTTGTAGATAATCTTGTTTGAGGCTTATT
                      ____________________________________________________________
consensus GCAAAGTGAAATCGGGGAGGGTGAAGTAACAGTTGTAGATAATCTTGTTTGAGGCTTATT
 
. : . : . : . : . : . :
rJMSF038O13+ AAATGGGGCTACCATGGAAGAAGAAGAAGAAGAAGAAGAATGCAGCCTTGATGGCTTGCT
rJMFF026G15+ AAATGGGGCTACCATGGAAGAAGAAGAAGAAGAAGAAGAATGCAGCCTTGATGGCTTGCT
                      ____________________________________________________________
consensus AAATGGGGCTACCATGGAAGAAGAAGAAGAAGAAGAAGAATGCAGCCTTGATGGCTTGCT
 
. : . : . : . : . : . :
rJMSF038O13+ AACTTAAATTTTACTTTTTGTTTCAATATTTATTGTAGTGGTAAGCTTATTGTGAAGTTG
rJMFF026G15+ AACTTAAATTTTACTTTTTGTTTCAATATTTATTGTAGTGGTAAGCTTATTGTCAAGTTG
                      ____________________________________________________________
consensus AACTTAAATTTTACTTTTTGTTTCAATATTTATTGTAGTGGTAAGCTTATTGTGAAGTTG
 
. : . : . : . : . : . :
rJMSF038O13+ ATAGTAGATCAAGGTTAACTTTGTTGTAAGTAATTACTTGCCAGCTTTTGTAATTTTGAA
rJMFF026G15+ ATAGTAGATCAAGGTTAACTTTGTTGTAAGTAATTACTTGCCAGCTTTTGTAATTTTGAA
                      ____________________________________________________________
consensus ATAGTAGATCAAGGTTAACTTTGTTGTAAGTAATTACTTGCCAGCTTTTGTAATTTTGAA
 
. : . : . : . : . : . :
rJMSF038O13+ GTTTTTACCCATTTGGGACAATGGGTACCAAATTTGCAAGT
rJMFF026G15+ GTTTTTACCCATTTGGGACAATGGGTACCAAATTTGCAAGTTGCAACATTCTCAAAANAA
                      ____________________________________________________________
consensus GTTTTTACCCATTTGGGACAATGGGTACCAAATTTGCAAGTTGCAACATTCTCAAAANAA