Previous Contig 009442:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026G07Sequence391009442 (12)gb:AF227626_17788641e-30Euphorbia esula 40S ribosomal protein S11 mRNA, complete cds.362009442 (12)gb:AF227626_17788641e-30Euphorbia esula 40S ribosomal protein S11 mRNA, complete cds.
JMFN020A11Sequence607009442 (12)sp|P25460|RS11_MAIZE2e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM
JMSF009L24Sequence355009442 (12)gb:AP003705_18321613e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ11674009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM
JMSF024F12Sequence661009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM677009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM
JMSF033G17Sequence665009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM643009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM
JMSF051I04Sequence662009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM673009442 (12)sp|P25460|RS11_MAIZE3e-7340S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM
JMSF052I04Sequence662004311 (11)pir|T51793|T517936e-84hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi673009442 (12)sp|P25460|RS11_MAIZE2e-7240S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF051I04- GGCTGCCTCTAGGGTTTTTA
rJMSF033G17+ GGCTGCCTCTAGGGTTTTTA
JMSF033G17- GGCTGCCTCTAGGGTTTTTA
JMSF024F12- CTGCCTCTAGGGTTTTTA
rJMSF052I04+ GGCTGCCTCTAGGGTTTTTA
rJMSF051I04+ GGCTGCCTCTAGGGTTTTTA
JMFN020A11- A
rJMSF009L24+ GCCTCTAGGGTTTTTA
JMSF009L24- GCCTCTAGGGTTTTTA
rJMSF024F12+ CTGCCTCTAGGGTTTTTA
                      ____________________________________________________________
consensus GGCTGCCTCTAGGGTTTTTA
 
. : . : . : . : . : . :
JMSF051I04- GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
rJMSF033G17+ GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
JMSF033G17- GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
JMSF024F12- GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGATACATCGGCGGCTACAATCATGGCGG
rJMSF052I04+ GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
rJMSF051I04+ GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
JMFN020A11- GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
rJMSF009L24+ GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
JMSF009L24- GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
rJMSF024F12+ GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGATACATCGGCGGCTACAATCATGGCGG
                      ____________________________________________________________
consensus GCTGCCGATCCAACTCGCTCCTATCTTCTTGCGACACATCGGCGGCTACAATCATGGCGG
 
. : . : . : . : . : . :
JMSF051I04- AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
rJMSF033G17+ AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
JMSF033G17- AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
JMSF024F12- AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
rJMSF052I04+ AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
rJMSF051I04+ AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
JMFN020A11- AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
rJMSF009L24+ AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
JMSF009L24- AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
rJMSF024F12+ AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
                      ____________________________________________________________
consensus AGCAGACTGAGAAGGCTTTCTTGAAGCAGCCGGGAGTTTTTCTCAGCTCGAAGAAAACAG
 
. : . : . : . : . : . :
JMSF051I04- GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
rJMSF033G17+ GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
JMSF033G17- GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
JMSF024F12- GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
rJMSF052I04+ GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
rJMSF051I04+ GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
JMFN020A11- GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
rJMSF009L24+ GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
JMSF009L24- GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
rJMSF024F12+ GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
                      ____________________________________________________________
consensus GGAAGGGTAAGAGGCCCGGTAAGGGAGGTAATCGATTCTGGAAGAGCATTGGATTAGGGT
 
. : . : . : . : . : . :
JMSF051I04- TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
rJMSF033G17+ TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
JMSF033G17- TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
JMSF024F12- TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
rJMSF052I04+ TTAAGACACCTCGCGAGGCTACTGAAGGGACATATANTGATAAAAAATGCCCCTTCACTG
rJMSF051I04+ TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
JMFN020A11- TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
rJMSF009L24+ TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
JMSF009L24- TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
rJMSF024F12+ TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
                      ____________________________________________________________
consensus TTAAGACACCTCGCGAGGCTACTGAAGGGACATATATTGATAAAAAATGCCCCTTCACTG
 
. : . : . : . : . : . :
JMSF051I04- GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
rJMSF033G17+ GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
JMSF033G17- GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
JMSF024F12- GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
rJMSF052I04+ GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
rJMSF051I04+ GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
JMFN020A11- GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
rJMSF009L24+ GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
JMSF009L24- GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
JMFF026G07- AATA
rJMSF024F12+ GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
rJMFF026G07+ AATA
                      ____________________________________________________________
consensus GTACTGTTTCTATCAGAGGTCGTATCCTTGCTGGGACATGCCATAGTGCTAAGATGAATA
 
. : . : . : . : . : . :
JMSF051I04- GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
rJMSF033G17+ GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
JMSF033G17- GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
JMSF024F12- GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
rJMSF052I04+ GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
rJMSF051I04+ GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
JMFN020A11- GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
rJMSF009L24+ GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
JMSF009L24- GAACAATCATTGTTCGTAGGAACTACCTTCACTTT
JMFF026G07- GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
rJMSF024F12+ GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
rJMFF026G07+ GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
                      ____________________________________________________________
consensus GAACAATCATTGTTCGTAGGAACTACCTTCACTTTGTGAAGAAGTACCAGAGGTATGAAA
 
. : . : . : . : . : . :
JMSF051I04- AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
rJMSF033G17+ AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
JMSF033G17- AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
JMSF024F12- AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
rJMSF052I04+ AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
rJMSF051I04+ AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
JMFN020A11- AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
rJMSF009L24+ AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
JMFF026G07- AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
rJMSF024F12+ AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
rJMFF026G07+ AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
                      ____________________________________________________________
consensus AAAGACACTCAAACATTGCTGCTCACATATCACCTTGCTTCCGTGTGAAAGAGGGAGATT
 
. : . : . : . : . : . :
JMSF051I04- ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
rJMSF033G17+ ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
JMSF033G17- ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
JMSF024F12- ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
rJMSF052I04+ ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTNTGAAG
rJMSF051I04+ ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
JMFN020A11- ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
rJMSF009L24+ ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
JMFF026G07- ACGTTTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
rJMSF024F12+ ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
rJMFF026G07+ ACGTTTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
                      ____________________________________________________________
consensus ACG-TTATCATTGGCCAATGCAGGCCATTGTCCAAAACTGTGAGGTTCAACGTTTTGAAG
 
. : . : . : . : . : . :
JMSF051I04- GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
rJMSF033G17+ GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
JMSF033G17- GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
JMSF024F12- GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
rJMSF052I04+ GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
rJMSF051I04+ GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
JMFN020A11- GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
rJMSF009L24+ GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
JMFF026G07- GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGC
rJMSF024F12+ GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
rJMFF026G07+ GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
                      ____________________________________________________________
consensus GTGATTCCTGCTGGCTCTGCTGGTGGCGGAAAGAAGGCGTTTACTGGCATGTGATTTTGC
 
. : . : . : . : . : . :
JMSF051I04- GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
rJMSF033G17+ GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
JMSF033G17- GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
JMSF024F12- GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
rJMSF052I04+ GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGNNGAACT
rJMSF051I04+ GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
JMFN020A11- GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTNTTTTGTTGAACT
rJMSF009L24+ GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
rJMSF024F12+ GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
rJMFF026G07+ GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
                      ____________________________________________________________
consensus GGTTTTCTTGTTAACATCAAATTATTCGAGTTATGATATTAGACTCTTTTTTGTTGAACT
 
. : . : . : . : . : . :
JMSF051I04- CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAG
rJMSF033G17+ CATACTATTCCAGTAGCC-CCATGT
JMSF033G17- CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAGATG
JMSF024F12- CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGA
rJMSF052I04+ CATACTA-TTCAGTAGCCACCATGTTTACATTTTTGAANGCTGAGANGTAGTCGA
rJMSF051I04+ CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAGATGTAGTCGAG
JMFN020A11- CATACTA
rJMSF009L24+ CATACTATTTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAGATGTAGTCGAG
rJMSF024F12+ CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAGATGTAGTCGAG
rJMFF026G07+ CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAGATGTAGTCGAGTTCT
                      ____________________________________________________________
consensus CATACTA-TTCAGTAGCC-CCATGTTTACATTTTTGAATGCTGAGATGTAGTCGAGTTCT