Previous Contig 009441:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026F13Sequence487001242 (2)gb:AB059832_15217833e-59Nicotiana tabacum MARBPF mRNA for MAR-binding protein, complete cds.464009441 (3)
JMFF036N18Sequence534001242 (2)gb:AB059832_15217834e-68Nicotiana tabacum MARBPF mRNA for MAR-binding protein, complete cds.334009441 (3)
JMSF009G11Sequence698009441 (3)gb:AB059832_15217833e-18Nicotiana tabacum MARBPF mRNA for MAR-binding protein, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF009G11+ TCGATATGATGCTCTTGGAGATGGACAAGATAATNCGATNGGATTAGAAAATCGGT
                      ____________________________________________________________
consensus TCGATATGATGCTCTTGGAGATGGACAAGATAATNCGATNGGATTAGAAAATCGGT
 
. : . : . : . : . : . :
rJMSF009G11+ NCAAGCTCGAGGCACGATTGAGAAANTTAGAAGGCAGAGAACTTGGCCGTCTATCAGGNT
                      ____________________________________________________________
consensus NCAAGCTCGAGGCACGATTGAGAAANTTAGAAGGCAGAGAACTTGGCCGTCTATCAGGNT
 
. : . : . : . : . : . :
rJMSF009G11+ CAGCTAAAGGCAATCCTAAGATTGAAGTCTATGATAAGGACTGCAAAAAAGGCTCTGGGG
                      ____________________________________________________________
consensus CAGCTAAAGGCAATCCTAAGATTGAAGTCTATGATAAGGACTGCAAAAAAGGCTCTGGGG
 
. : . : . : . : . : . :
rJMSF009G11+ GGTTGATTACTCCAGCTAAGACTTACAATCCTTCGGCTGATTCNGTTCTTGGGCATACCG
                      ____________________________________________________________
consensus GGTTGATTACTCCAGCTAAGACTTACAATCCTTCGGCTGATTCNGTTCTTGGGCATACCG
 
. : . : . : . : . : . :
rJMSF009G11+ AGCCANCTNCCAATGNGGAGGATAAGATGGAAGTAGAGACGAGGCTAGACGAAGTAGCTG
                      ____________________________________________________________
consensus AGCCANCTNCCAATGNGGAGGATAAGATGGAAGTAGAGACGAGGCTAGACGAAGTAGCTG
 
. : . : . : . : . : . :
rJMSF009G11+ AAGCAGTTGAGGCTCCCGCTAATGAAGAGAGCAAGANGAAGAAGAAGAAAAAGAAGGAAA
rJMFF026F13+ ATGAAGNGAGCNAGAAGAAGAAGAAGAAAAAGAAGGNAA
                      ____________________________________________________________
consensus AAGCAGTTGAGGCTCCCGCTAATGAAGAGAGCAAGAAGAAGAAGAAGAAAAAGAAGGAAA
 
. : . : . : . : . : . :
rJMSF009G11+ CAGCTGTTGAAGAGGACGCTGGTGAACCCGAGAACGAAGAGGTAGGGAGGAAGGAGNAGA
rJMFF036N18+ GTGAACCCGAGAACGAAGAGGTNGGGNGGAAGGNGAAGA
rJMFF026F13+ CNGCTGTTGAAGAGGNCNCTGGTGAACCCGAGAACGAAGAGGTNGGGAGGAAGGNGAAGA
                      ____________________________________________________________
consensus CAGCTGTTGAAGAGGACGCTGGTGAACCCGAGAACGAAGAGGTAGGGAGGAAGGAGAAGA
 
. : . : . : . : . : . :
rJMSF009G11+ AAAAGAAANANCATTCANCCGAGGGGGGTGAAGGGCAGAATAGTGAAGAAAATGCTGAAA
rJMFF036N18+ AAAAAAAAAAGCATTCAGCCGAGGGGGGTGAAGGGCAGAATAGTGAAGAAAATGCTGAAA
rJMFF026F13+ AAAAAAAAAAGCATTCAGCCGAGGGGGGTGAAGGGCAGAATAGTGAAGAAAATGCTGAAA
                      ____________________________________________________________
consensus AAAAAAAAAAGCATTCAGCCGAGGGGGGTGAAGGGCAGAATAGTGAAGAAAATGCTGAAA
 
. : . : . : . : . : . :
rJMSF009G11+ CTGGNGAGAAGNAGAAAAAGAAGAGAAAGCATGCCGAGGCTGAAGAAGAAGAAGAGGAAA
rJMFF036N18+ CTGGAGAGAAGAAGAAAAAGAAGAGAAAGCATGCCGAGGCTGAAGAAGAAGAAGAGGAAA
rJMFF026F13+ CTGGAGAGAAGAAGAAAAAGAAGAGAAAGCATGCCGAGGCTGAAGAAGAAGAAGAGGAAA
                      ____________________________________________________________
consensus CTGGAGAGAAGAAGAAAAAGAAGAGAAAGCATGCCGAGGCTGAAGAAGAAGAAGAGGAAA
 
. : . : . : . : . : . :
rJMSF009G11+ CTGACTCGACCAAGAAGAAAGACAAGAAGAAGAAGAAGAAGAAACTCTGCGGATTGATTG
rJMFF036N18+ CTGAATCGACCAAGAAGAAAGACAAGAAGAAGAAGAAGAAAA----CTGCGGATTGATTG
rJMFF026F13+ CTGAATCGACCAAGAAGAAAGACAAGAAGAAGAAGAAGAAAA----CTGCGGATTGATTG
                      ____________________________________________________________
consensus CTGAATCGACCAAGAAGAAAGACAAGAAGAAGAAGAAGAAAA----CTGCGGATTGATTG
 
. : . : . : . : . : . :
rJMSF009G11+ TCACATTAAAATGTGTACACAATTTTGGTATGTACTGGCCTTGTTTTAGTGTTTGAAAAT
rJMFF036N18+ TCACATTAAAATGTGTACACAATTTTGGTATGTACTGGCCTTGTTTTAGTGTTTGAAAAT
rJMFF026F13+ TCACATTAAAATGTGTACACAATTTTGGTATGTACTGGCCTTGTTTTAGTGTTTGAAAAT
                      ____________________________________________________________
consensus TCACATTAAAATGTGTACACAATTTTGGTATGTACTGGCCTTGTTTTAGTGTTTGAAAAT
 
. : . : . : . : . : . :
rJMSF009G11+ CTTGTCATGTTTTCCAAGCCCCTATGACTTCTACAGAAATAT
rJMFF036N18+ CTTGTCATGTTTTCCAAGCCCCTATGACTTCTACAGAAATATTGTATTTTCAACTCAAT
rJMFF026F13+ CTTGTCATGTTTTCCAAGCCCCTATGACTTCTACAGAAATATTGTATTTTCAACTCAATG
                      ____________________________________________________________
consensus CTTGTCATGTTTTCCAAGCCCCTATGACTTCTACAGAAATATTGTATTTTCAACTCAATG