Previous Contig 009437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026F03Sequence510009437 (4)gb:AP003267_18267745e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P049792009437 (4)pir|T04647|T046472e-15hypothetical protein F10N7.210 - Arabidopsis thaliana>gb:ATCHRIV76_1547119 Arabi
JMFF029L19Sequence418009437 (4)pir|T45866|T458662e-14hypothetical protein F3A4.210 - Arabidopsis thaliana>gb:ATF3A4_1550567 Arabidops796009437 (4)pir|T04647|T046473e-15hypothetical protein F10N7.210 - Arabidopsis thaliana>gb:ATCHRIV76_1547119 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF029L19- GACATCA
JMFF026F03- GACATCA
                      ____________________________________________________________
consensus GACATCA
 
. : . : . : . : . : . :
JMFF029L19- TATACATTCATTATATTCAACAAAATTAAAGATGCAAGGATCAGCTAGTACTAGTAGTAG
JMFF026F03- TATACATTCATTATATTCAACAAAATTAAAGATGCAAGGATCAGCTAGTACTAGTAGTAG
                      ____________________________________________________________
consensus TATACATTCATTATATTCAACAAAATTAAAGATGCAAGGATCAGCTAGTACTAGTAGTAG
 
. : . : . : . : . : . :
JMFF029L19- CGCAACGATCGATCATGTCACAGTAGAAATCATTCCAGAGGAGACTCTCAATCTCCTCTC
JMFF026F03- CGCAACGATCGATCATGTCACAGTAGAAATCATTCCAGAGGAGACTCTCAATCTCCTCTC
                      ____________________________________________________________
consensus CGCAACGATCGATCATGTCACAGTAGAAATCATTCCAGAGGAGACTCTCAATCTCCTCTC
 
. : . : . : . : . : . :
JMFF029L19- CTCGATCAACTCCAAAATGGAGTCCCTCTCCATCTCCAATTGCATCTGCAGACTCCCCCA
JMFF026F03- CTCGATCAACTCCAAAATGGAGTCCCTCTCCATCTCCAATTGCATCTGCAGACTCCCCCA
                      ____________________________________________________________
consensus CTCGATCAACTCCAAAATGGAGTCCCTCTCCATCTCCAATTGCATCTGCAGACTCCCCCA
 
. : . : . : . : . : . :
JMFF029L19- ACACGTTTCCAAAGGCAACGAACACAACTACTTCCCTAAACGCGTCTCGATCGGCCCCTT
JMFF026F03- ACACGTTTCCAAAGGCAACGAACACAACTACTTCCCTAAACGCGTCTCGATCGGCCCCTT
                      ____________________________________________________________
consensus ACACGTTTCCAAAGGCAACGAACACAACTACTTCCCTAAACGCGTCTCGATCGGCCCCTT
 
. : . : . : . : . : . :
JMFF029L19- CCACCGCGGAAACGCCGCCCTGAGAGCCATGGAGGTCCAGAAATGGCGGTACCTCAACGC
JMFF026F03- CCACCGCGGAAACGCCGCCCTGAGAGCCATGGAGGTCCAGAAATGGCGGTACCTCAACGC
                      ____________________________________________________________
consensus CCACCGCGGAAACGCCGCCCTGAGAGCCATGGAGGTCCAGAAATGGCGGTACCTCAACGC
 
. : . : . : . : . : . :
JMFF029L19- CCTGCTCAGCCGCGGCGGACAGGACACGGAATCCGCCTTGGACGCCTGCATCGAGCGATT
JMFF026F03- CCTGCTCAGCCGCGGCGGACAGGACACGGAATCCGCCTTGGACGCCTGCATCGAGCGATT
                      ____________________________________________________________
consensus CCTGCTCAGCCGCGGCGGACAGGACACGGAATCCGCCTTGGACGCCTGCATCGAGCGATT
 
. : . : . : . : . : . :
JMFF029L19- GCGGCGGTTAGAATCGCGAGCCAGGAAATGCTACGGCGGCGGCGGAGAAGG
JMFF026F03- GCGGCGGTTAGAATCGCGAGCCAGGAAATGCTACGGCGGCGGCGGAGAAGGGAGGATGAT
rJMFF029L19+ AGGGAGGATGAT
rJMFF026F03+ AGGGAGGATGAT
                      ____________________________________________________________
consensus GCGGCGGTTAGAATCGCGAGCCAGGAAATGCTACGGCGGCGGCGGAGAAGGGAGGATGAT
 
. : . : . : . : . : . :
JMFF026F03- CGGCCTGGGGAGAGACGAGTTCGTGGAGATGATGTTGCTCGACGGTTGCTTCATCATCGA
rJMFF029L19+ CGGCCTGGGGAGAGACGAGTTCGTGGAGATGATGTTGCTCGACGGTTGCTTCATCATCGA
rJMFF026F03+ CGNCCTGGGGAGAGACGAGTTCGTGGAGATGATGTTGCTCGACGGTTGCTTCATCATCGA
                      ____________________________________________________________
consensus CGGCCTGGGGAGAGACGAGTTCGTGGAGATGATGTTGCTCGACGGTTGCTTCATCATCGA
 
. : . : . : . : . : . :
JMFF026F03- GCTCCTCCTCAGGTTCGCGTTCC
rJMFF029L19+ GCTCCTCCTCAGGTTCGCGTTCCGAGGAATCCGCCGGAAAGACGATCCGTGTTTCAGCTC
rJMFF026F03+ GCTCCTCCTCAGGTTCGCGTTCCGAGGAATCCGCCGGAAAGACGATCCGTGTTTCAGCTC
                      ____________________________________________________________
consensus GCTCCTCCTCAGGTTCGCGTTCCGAGGAATCCGCCGGAAAGACGATCCGTGTTTCAGCTC
 
. : . : . : . : . : . :
rJMFF029L19+ GCGGGAGGCGTTCTCCGGCGTCAGGAGCGATTTGATTTTGGCTGAGAATCAAATTCCGTT
rJMFF026F03+ GCGGGAGGCGTTCTCCGGCGTCAGGAGCGATTTGATTTTGGCTGAGAATCAAATTCCGTT
                      ____________________________________________________________
consensus GCGGGAGGCGTTCTCCGGCGTCAGGAGCGATTTGATTTTGGCTGAGAATCAAATTCCGTT
 
. : . : . : . : . : . :
rJMFF029L19+ TTTTGTTGTTGAGCATTTGTATAAGGTGGTTCCTCTTCCCAAAGACTGCTCCTCTTTCTC
rJMFF026F03+ TTTTGTTGTTGAGCATTTGTATAAGGTGGTTCCTCTTCCCAAAGACTGCTCCTCTTTCTC
                      ____________________________________________________________
consensus TTTTGTTGTTGAGCATTTGTATAAGGTGGTTCCTCTTCCCAAAGACTGCTCCTCTTTCTC
 
. : . : . : . : . : . :
rJMFF029L19+ GCTCGCTCATCTCTTCCTGTTATTCGTCAGGAAGTTGATCGACCGGCCGCCGGAAGGATC
rJMFF026F03+ GCTCGCTCATCTCTTCCTGTTATTCGTCAGGAAGTTGATCGACCGGCCGCCGGAAGGATC
                      ____________________________________________________________
consensus GCTCGCTCATCTCTTCCTGTTATTCGTCAGGAAGTTGATCGACCGGCCGCCGGAAGGATC
 
. : . : . : . : . : . :
rJMFF029L19+ ATTGCCGGCGACTCAGGATCAGAAATTTGGACCGTTTGTGTATCATTTACTTGATCTCGT
rJMFF026F03+ ATTGCCGGCGACTCAGGATCAGAAATTTGGACCGTTTGTGTATCATTTACTTGATCTCGT
                      ____________________________________________________________
consensus ATTGCCGGCGACTCAGGATCAGAAATTTGGACCGTTTGTGTATCATTTACTTGATCTCGT
 
. : . : . : . : . : . :
rJMFF029L19+ TCGCCATTGTTACTTGCCTGCAACTCCTCCATTGCAATCAACTGCAACTGGAGAGCAGAA
rJMFF026F03+ TCGCCATTGTTACTTGCCTGCAACTCCTCCATTGCAATCAACTGCAACTGGAGAGCAGAA
                      ____________________________________________________________
consensus TCGCCATTGTTACTTGCCTGCAACTCCTCCATTGCAATCAACTGCAACTGGAGAGCAGAA
 
. : . : . : . : . : . :
rJMFF029L19+ GAATCTCTATTCTGCAACTCAACTTCAAGCTGCAGGTACAACTAACCACATTCCACTAAT
rJMFF026F03+ GAATCTCTATTCTGCAACTCAACTTCAAGCTGCAGGTACAACTAACCACATTCCACTAAT
                      ____________________________________________________________
consensus GAATCTCTATTCTGCAACTCAACTTCAAGCTGCAGGTACAACTAACCACATTCCACTAAT
 
. : . : . : . : . : . :
rJMFF029L19+ TGTGCAAAGGTCGTTGATCGAAGGAAGTAAATTGTCCCGTTCTCAAATTCTCAGGCCTTG
rJMFF026F03+ TGTGCAAAGGTCGTTGATCGAAGGAAGTAAATTGTCCCGTTCTCAAATTCTCAGGCCTTG
                      ____________________________________________________________
consensus TGTGCAAAGGTCGTTGATCGAAGGAAGTAAATTGTCCCGTTCTCAAATTCTCAGGCCTTG
 
. : . : . : . : . : . :
rJMFF029L19+ TTTATGATGGGTTGTCTCCCAATAACGAGTGATAGATCAAATCAACTCATCAGTTAGCCC
rJMFF026F03+ TTTATGATGGGTTGTCTCCCAATAACGAGTGATAGATCAAATCAACTCATCAGTTAGCCC
                      ____________________________________________________________
consensus TTTATGATGGGTTGTCTCCCAATAACGAGTGATAGATCAAATCAACTCATCAGTTAGCCC
 
. : . : . : . : . : . :
rJMFF029L19+ GCCAGGCTAATTGTGCCCTTTAAAAAAATAAAATAAATATTAGGCCAGACTAGTTTAAGT
rJMFF026F03+ GCCAGGCTAATTGTGCCCTTTAAAAAAATAAAATAAATATTAGGCCAGACTAGTTTAAGT
                      ____________________________________________________________
consensus GCCAGGCTAATTGTGCCCTTTAAAAAAATAAAATAAATATTAGGCCAGACTAGTTTAAGT
 
. : . : . : . : . : . :
rJMFF029L19+ CTTCAAAATCTCTGTCTAAGAGTCGATGGAAGAGGTAAATCGTGAATGGCCTTTAGTTCC
rJMFF026F03+ CTTCAAAATCTCTGTCTAAGAGTCGATGGAAGAGGTAAATCGTGAATGGCCTTTAGTTCC
                      ____________________________________________________________
consensus CTTCAAAATCTCTGTCTAAGAGTCGATGGAAGAGGTAAATCGTGAATGGCCTTTAGTTCC
 
. : . : . : . : . : . :
rJMFF029L19+ CAGGTTCTCACCTCTTGCCTATGATAACCTTAGGCTCCCAATAAGAGTGA
rJMFF026F03+ CAGGTTCTCACCTCTTGCCTATGATAACCTTAGGCTCCCAATAAGAGTGATAAGTNGAAA
                      ____________________________________________________________
consensus CAGGTTCTCACCTCTTGCCTATGATAACCTTAGGCTCCCAATAAGAGTGATAAGTNGAAA