Previous Contig 009432:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018F16Sequence540002177 (5)gb:AP003225_18256082e-65Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001776009432 (4)gb:HSM805459_20179102e-06Homo sapiens mRNA; cDNA DKFZp434K1526 (from clone DKFZp434K1526).
JMFF026D08Sequence539002177 (5)gb:AP003225_18256085e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001788009432 (4)gb:HSM805459_20179102e-05Homo sapiens mRNA; cDNA DKFZp434K1526 (from clone DKFZp434K1526).
JMFF028D16Sequence483002177 (5)gb:AP003225_18256082e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001690009432 (4)gb:CR749335_11809634e-08Homo sapiens mRNA; cDNA DKFZp781D2023 (from clone DKFZp781D2023).
JMFF050O07Sequence626002177 (5)gb:AP003225_18256081e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P001581009432 (4)gb:HSM805459_20179101e-05Homo sapiens mRNA; cDNA DKFZp434K1526 (from clone DKFZp434K1526).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018F16+ CTATAG
                      ____________________________________________________________
consensus CTATAG
 
. : . : . : . : . : . :
rJMFF018F16+ CCGGTCAAGATCGCNTGCAACGGCTGCAAGGAGAGAACAAGTTGAGCACGAGAGAAGATC
                      ____________________________________________________________
consensus CCGGTCAAGATCGCNTGCAACGGCTGCAAGGAGAGAACAAGTTGAGCACGAGAGAAGATC
 
. : . : . : . : . : . :
rJMFF018F16+ CAGGAGCCCTGCAATCAGCAGAAGCCCCGAGCGAAGAAGTGCTACTCCCTNTAAAACACA
                      ____________________________________________________________
consensus CAGGAGCCCTGCAATCAGCAGAAGCCCCGAGCGAAGAAGTGCTACTCCCTNTAAAACACA
 
. : . : . : . : . : . :
rJMFF018F16+ GAAGCGCAGCCCAAACCCCATTGAGGCCAGCCCCCCAAGCCGGAGGGAAGAGAGTCCTTC
rJMFF028D16+ GAGGCCAGCCCCCCAAGCCGGAGGGAAGAGAGTCNTTN
                      ____________________________________________________________
consensus GAAGCGCAGCCCAAACCCCATTGAGGCCAGCCCCCCAAGCCGGAGGGAAGAGAGTCCTTC
 
. : . : . : . : . : . :
rJMFF018F16+ TAAGAGGGGAAAGGTGATGACAGACCAAGATGGCTATGACAGAAGCCCTCCTTCTAAGAG
rJMFF028D16+ TAAGAGGGGAAAGGTGATGACAGACCAAGATGGCTATGACAGAAGCCCTCCTTTTAAGAG
rJMFF026D08+ TAAGAGGGGAAAGNTGATGACAGACCAAGATGGCTATGACAGAAGCCNTCCTTNTAAGAG
                      ____________________________________________________________
consensus TAAGAGGGGAAAGGTGATGACAGACCAAGATGGCTATGACAGAAGCCCTCCTTTTAAGAG
 
. : . : . : . : . : . :
rJMFF018F16+ GGCAAAGGCAATGACAGAACAAGATGGCTATGACAGAAGTCCTCCTTCTAAGAGGGCAAA
rJMFF028D16+ GGCAAAGGCAATGACAGAACAAGATGGCTATGACAGAAGTCCTCCTTCTAAGAGGGCAAA
rJMFF050O07+ GGGCAAA
rJMFF026D08+ GGCAAAGGCAATGACAGAACAAGATGNCTATGACAGAAGTCCTCCTTCTAAGAGGGCAAA
                      ____________________________________________________________
consensus GGCAAAGGCAATGACAGAACAAGATGGCTATGACAGAAGTCCTCCTTCTAAGAGGGCAAA
 
. : . : . : . : . : . :
rJMFF018F16+ GGCAATGACAGAACAAGATGACTATGACAGAAGCCCTCCTTCTAAGAGGGAAAAGGTGAT
rJMFF028D16+ GGCAATGACAGAACAAGATGACTATGACAGAAGCCCTCCTTCTAAGAGGGAAAAGGTGAT
rJMFF050O07+ GGCAATGACAGAACAAGATGACTATGACAGAAGCCCTCCTTCTAAGAGGGAAAAGGTGAT
rJMFF026D08+ GGCAATGACAGAACAAGATGACTATGACAGAAGCCCTCCTTCTAAGAGGGAAAAGGTGAT
                      ____________________________________________________________
consensus GGCAATGACAGAACAAGATGACTATGACAGAAGCCCTCCTTCTAAGAGGGAAAAGGTGAT
 
. : . : . : . : . : . :
rJMFF018F16+ GACAGAAGAAGATGGCTATGGCAGAAGCCCTAAGGGGAAAAGAAGCCATAGTCCTTCTAA
rJMFF028D16+ GACAGAAGAAGATGGCTATGGCAGAAGCCCTAAGGGGAAAAGAAGCCATAGTCCTTCTAA
rJMFF050O07+ GACAGAAGAAGATGGCTATGGCAGAAGCCCTAAGGGGAAAAGAAGCCATAGTCCTTCTAA
rJMFF026D08+ GACAGAAGAAGATGGCTATGGCAGAAGCCCTAAGGGGAAAAGAAGCCATAGTCCTTCTAA
                      ____________________________________________________________
consensus GACAGAAGAAGATGGCTATGGCAGAAGCCCTAAGGGGAAAAGAAGCCATAGTCCTTCTAA
 
. : . : . : . : . : . :
rJMFF018F16+ GAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCCTAAGGGGAAACGAAG
rJMFF028D16+ GAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCCTAAGGGGAAACGAAG
rJMFF050O07+ GAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCCTAAGGGGAAACGAAG
rJMFF026D08+ GAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCCTAAGGGGAAACGAAG
                      ____________________________________________________________
consensus GAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCCTAAGGGGAAACGAAG
 
. : . : . : . : . : . :
rJMFF018F16+ CCATATTCCTTCTAAGAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCC
rJMFF028D16+ CCATATTCCTTCTAAGAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCC
rJMFF050O07+ CCATATTCCTTCTAAGAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCC
rJMFF026D08+ CCATATTCCTTCTAAGAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCN
                      ____________________________________________________________
consensus CCATATTCCTTCTAAGAGGGAAAAGGTGATGACAGAAGAAGATGGCTATGACAGAAGCCC
 
. : . : . : . : . : . :
rJMFF018F16+ TAAGGGGAAAAGAAGCCATAGTCCTTCGAGCCCTGAAAGAGGGAGCATAGCTCCTAGGAA
rJMFF028D16+ TAAGGGGAAAAGAAGCCATAGTCCTTCGAGCCCTGAAAGAGGGAGCATAGCTCCTAGGAA
rJMFF050O07+ TAAGGGGAAAAGAAGCCATAGTCCTTCGAGCCCTGAAAGAGGGAGCATAGCTCCTAGGAA
rJMFF026D08+ TAAGGGGAAAAGAAGCCATAGTCCTTCGAGCCCTGAAAGAGGGAGCATAGCTCCTAGGAA
                      ____________________________________________________________
consensus TAAGGGGAAAAGAAGCCATAGTCCTTCGAGCCCTGAAAGAGGGAGCATAGCTCCTAGGAA
 
. : . : . : . : . : . :
rJMFF018F16+ GTATGATGAGAGCCCTTTCGAAGCTAATGGTCGCAGTGGCAGCAGCCCAAGTCCAAGGTA
rJMFF028D16+ GTATGATGAGAGCCCTTTCGAAGCTAATGGTCGCAGTGGCAGCAGCCCAAGTCCAAGGTA
rJMFF050O07+ GTATGATGAGAGCCCTTTCGAAGCTAATGGTCGCAGTGGCAGCAGCCCAAGTCCAAGGTA
rJMFF026D08+ GTATGATGAGAGCCCTTTCGAAGCTAATGGTCGCAGTGGCAGCAGCCCAAGTCCAAGGTA
                      ____________________________________________________________
consensus GTATGATGAGAGCCCTTTCGAAGCTAATGGTCGCAGTGGCAGCAGCCCAAGTCCAAGGTA
 
. : . : . : . : . : . :
rJMFF018F16+ TGAAAGGAGCCCTGCTGATGACCGGGATGATAATTAGCTATCGCAATAGGCAGCCTGTTC
rJMFF028D16+ TGAAAGGAGCCCTGCTGATGACCGGGATGATAATTAGCTATCGCAATAGGCAGCCTGTTC
rJMFF050O07+ TGAAAGGAGCCCTGCTGATGACCGGGATGATAATTAGCTATCGCAATAGGCAGCCTGTTC
rJMFF026D08+ TGAAAGGAGCCCTGCTGATGACCGGGATGATAATTAGCTATCGCAATAGGCAGCCTGTTC
                      ____________________________________________________________
consensus TGAAAGGAGCCCTGCTGATGACCGGGATGATAATTAGCTATCGCAATAGGCAGCCTGTTC
 
. : . : . : . : . : . :
rJMFF018F16+ CCATTGTTTGAAGTCAGAATGATCAATATCTTTATGGGAGAGAAACTTTT
rJMFF028D16+ CCATTGTTTGAAGTCAGAATGATCAATATCTTTATGGGAGAGAAACTTTTGTCCTTAACA
rJMFF050O07+ CCATTGTTTGAAGTCAGAATGATCAATATCTTTATGGGAGAGAAACTTTTGTCCTTAACA
rJMFF026D08+ CCATTGTTTGAAGTCAGAATGATCAATATCTTTATGGGAGAGAAACTTTTGTCCTTAACA
                      ____________________________________________________________
consensus CCATTGTTTGAAGTCAGAATGATCAATATCTTTATGGGAGAGAAACTTTTGTCCTTAACA
 
. : . : . : . : . : . :
rJMFF028D16+ ATGCATTTATTTCTTTTACAATTTCTCTGGTCTTTAGACCTTGTGAACACTA
rJMFF050O07+ ATGCATTTATTTCTTTTACAATTTCTCTGGTCTTTAGACCTTGTGAACACTATGTTATGA
rJMFF026D08+ ATGCATTTATTTCTTTTACAATTTCTCTGGTCTTTAGACCTTGTGAACACTATGTTATGA
                      ____________________________________________________________
consensus ATGCATTTATTTCTTTTACAATTTCTCTGGTCTTTAGACCTTGTGAACACTATGTTATGA
 
. : . : . : . : . : . :
rJMFF050O07+ AATGTACTGCAGGCAGTTAAGACTTCATTGACCC
rJMFF026D08+ AATGTACTGCAGGCAGTTAAGACTTCATTGACCCATACAATGCTCTATTTTACTCATCTG
                      ____________________________________________________________
consensus AATGTACTGCAGGCAGTTAAGACTTCATTGACCCATACAATGCTCTATTTTACTCATCTG
 
. : . : . : . : . : . :
rJMFF026D08+ TTTAAATNGAAAGATGGGTAAGACCATTTGTATTGGCGTATTGGATAGTCTAGACAAAGG
                      ____________________________________________________________
consensus TTTAAATNGAAAGATGGGTAAGACCATTTGTATTGGCGTATTGGATAGTCTAGACAAAGG