Previous Contig 009422:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026A03Sequence578001228 (3)712009422 (3)gb:CQ759959_14516603e-70Sequence 5 from Patent WO2004003185.
JMSF014E22Sequence109001228 (3)676009422 (3)gb:CQ759959_14516607e-65Sequence 5 from Patent WO2004003185.
JMSF015E22Sequence212005536 (10)688009422 (3)gb:CQ759959_14516608e-70Sequence 5 from Patent WO2004003185.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014E22+ TTTTATCTACCTGAGAGCAAGCCCTGATACTTGCCACAAGAGAATGATG
rJMSF015E22+ TTTTATNTACCTGAGAGCAAGCCCTGATACTTGCCACAAGAGAATGATG
rJMFF026A03+ GATGGTTTTATCTACCTGAGAGCAAGCCNTGATACTTGCCACAAGAGAATGATG
                      ____________________________________________________________
consensus GATGGTTTTATCTACCTGAGAGCAAGCCCTGATACTTGCCACAAGAGAATGATG
 
. : . : . : . : . : . :
rJMSF014E22+ CTGCGAAAGAGAGCTGAGGAAGGTGGAGTCTCCCTCGAGTATTTGCGAGACTTGCATGAA
rJMSF015E22+ CTGCGAAAGAGAGNTGAGGAAGGTGGAGTNTCCCTNGAGTATCTGCGAGACTTGCATGAA
rJMFF026A03+ CTGCGAAAGAGAGCTGAGGAAGGTGGAGTCTCCCTCGAGTATTTGCGAGACTTGCATGAA
                      ____________________________________________________________
consensus CTGCGAAAGAGAGCTGAGGAAGGTGGAGTCTCCCTCGAGTATTTGCGAGACTTGCATGAA
 
. : . : . : . : . : . :
rJMSF014E22+ AAGCATGAGAACTGGCTTTTCCCATTCGAAAGTGGAAATCATGGGATTTTATCAGTCAGT
rJMSF015E22+ AAGCATGAGAACTGGCTTTTCCCATTCGAAAGTGGAAATCATGGGATTTTATCAGTCAGT
rJMFF026A03+ AAGCATGAGAACTGGCTTTTCCCATTCGAAAGTGGAAATCATGGGATTTTATCAGTCAGT
                      ____________________________________________________________
consensus AAGCATGAGAACTGGCTTTTCCCATTCGAAAGTGGAAATCATGGGATTTTATCAGTCAGT
 
. : . : . : . : . : . :
rJMSF014E22+ CAACTGCCACAGAGCTTTGACAATTCCTTACCTTCAGAGATTAGGGATCGAGTTTTTTTA
rJMSF015E22+ CAACTGCCACNGAGCTTTGACAATTCNTTACCTTCNGAGATTAGGGATCGAGTTTTTTTA
rJMFF026A03+ CAACTGCCACAGAGCTTTGACAATTCCTTACCTTCAGAGATTAGGGATCGAGTTTTTTTA
                      ____________________________________________________________
consensus CAACTGCCACAGAGCTTTGACAATTCCTTACCTTCAGAGATTAGGGATCGAGTTTTTTTA
 
. : . : . : . : . : . :
rJMSF014E22+ TTTGGAGGGTAATCATATGCATCCAAGTATTCAAAAGGTTCCTGCTTTGGTCCTTGATTG
rJMSF015E22+ TTTGGAGGGTAATCATATGCATCCAAGTATTCAAAAGGTTCCTGCTTTGGTCCTTGATTG
rJMFF026A03+ TTTGGAGGGTAATCATATGCATCCAAGTATTCAAAAGGTTCCTGCTTTGGTCCTTGATTG
                      ____________________________________________________________
consensus TTTGGAGGGTAATCATATGCATCCAAGTATTCAAAAGGTTCCTGCTTTGGTCCTTGATTG
 
. : . : . : . : . : . :
rJMSF014E22+ TGAGCCCAACATTGACTTCAATAAAGATATTGAAGCAAAGAGACAGTACGCTCGCCAGGT
rJMSF015E22+ TGAGCCCAACATTGACTTCAATAAAGATATTGAAGCAAAGAGNCAGTACGCTCNCCAGGT
rJMFF026A03+ TGAGCCCAACATTGACTTCAATAAAGATATTGAAGCAAAGAGACAGTACGCTCGCCAGGT
                      ____________________________________________________________
consensus TGAGCCCAACATTGACTTCAATAAAGATATTGAAGCAAAGAGACAGTACGCTCGCCAGGT
 
. : . : . : . : . : . :
rJMSF014E22+ TGCTGAATTCTTCGAATTTGTGAAGAAAAAGAAAGAAGTTAACGCTCCTGGAGCTGGTGA
rJMSF015E22+ TGCTGAATTCTTNGAATNTGTGAAGAAAAAGAAAGAAGTTAACGCTCCTGGAGCTGGTGA
rJMFF026A03+ TGCTGAATTCTTCGAATTTGTGAAGAAAAAGAAAGAAGTTAACGCTCCTGGAGCTGGTGA
                      ____________________________________________________________
consensus TGCTGAATTCTTCGAATTTGTGAAGAAAAAGAAAGAAGTTAACGCTCCTGGAGCTGGTGA
 
. : . : . : . : . : . :
rJMSF014E22+ AGATTCAACGAAGGGTAATCAACCAGAGGTGCTGCTGCCTGACAGACCGGGATTGTGGGT
rJMSF015E22+ AGATTCAACGAAGGGTAATCAACCAGAGGTGNTGCTGCCTGNCAGACCGGGATTGTGGGT
rJMFF026A03+ AGATTCAACGAAGGGTAATCAACCAGAGGTGCTGCTGCCTGACAGACCGGGATTGTGGGT
                      ____________________________________________________________
consensus AGATTCAACGAAGGGTAATCAACCAGAGGTGCTGCTGCCTGACAGACCGGGATTGTGGGT
 
. : . : . : . : . : . :
rJMSF014E22+ ACCTGAGGGCAAATTCTCAGAGTCAGGCCTAAAATNTTNGGATTTTNGACGAATCAATGT
rJMSF015E22+ ACCTGAGGGCAAATTCTCAGAGTCAGGCCTAAAATCTTTGGATTTTAGACGAA-CAATGT
rJMFF026A03+ ACCTGAGGGCAAATTCTCAGAGTCAGGCCTAAAATCTTTGGATTTTAGACGAA-CAATGT
                      ____________________________________________________________
consensus ACCTGAGGGCAAATTCTCAGAGTCAGGCCTAAAATCTTTGGATTTTAGACGAA-CAATGT
 
. : . : . : . : . : . :
rJMSF014E22+ CATTTATGTCCCACTAGACTAGAGGGATATCCTTGCCAGNTGCCA-GTACCCAGGAGAAG
rJMSF015E22+ CATTTATGTCCCACTAGACTAGAGGGATATCCTTNCCAGTTGCCATGTACCCAGGAGAAG
rJMFF026A03+ CATTTATGTCCCACTAGACTAGAGGGATATCCTTGCCAGTTGCCA-GTACCCAGGAGAAG
                      ____________________________________________________________
consensus CATTTATGTCCCACTAGACTAGAGGGATATCCTTGCCAGTTGCCA-GTACCCAGGAGAAG
 
. : . : . : . : . : . :
rJMSF014E22+ GGGGTTGGGTTGGGTNGCTGATTAATCAGTCTGCCTGTAAAAAGTTGTAGTNGATTGCTT
rJMSF015E22+ GGGGTTGGGTTGGGTTGTTGATTAATCAGTCTGCCTGTAAAAAGTNGTANTTGATNGCTT
rJMFF026A03+ GGGGTTGGGTTGGGTTGTTGATTAATCAGTCTGCCTGTAAAAAGTTGTAGTTGATTGCTT
                      ____________________________________________________________
consensus GGGGTTGGGTTGGGTTGTTGATTAATCAGTCTGCCTGTAAAAAGTTGTAGTTGATTGCTT
 
. : . : . : . : . : . :
rJMSF014E22+ AGTCTTGAACCT
rJMSF015E22+ AGTCTTGAACCTTTGACAATGTAGAGNTAACGATGT
rJMFF026A03+ AGTCTTGAACCTTTGACAATGTAGAGTTAACGATGTTCCTTTGTGGATGCTATAAGACCA
                      ____________________________________________________________
consensus AGTCTTGAACCTTTGACAATGTAGAGTTAACGATGTTCCTTTGTGGATGCTATAAGACCA