Previous Contig 009413:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013P22Sequence557000729 (2)gb:OSJN00175_16962084e-38Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064D20, complete seque706009413 (2)pir|B86458|B864582e-08probable protein nitrate transporter NTL1 54085-51470 [imported] - Arabidopsis t
JMFF025M11Sequence558000729 (2)gb:OSJN00175_16962084e-38Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064D20, complete seque697009413 (2)pir|B86458|B864582e-07probable protein nitrate transporter NTL1 54085-51470 [imported] - Arabidopsis t

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013P22+ TG
                      ____________________________________________________________
consensus TG
 
. : . : . : . : . : . :
rJMFF013P22+ GTCAACAAGATTACCTCAACTCTTAAAAAGGGAGGGTGGCTTAGTGACAATGATCTCAAC
rJMFF025M11+ TAAAAAGGGAGGGTGGCTTAGTGACAATGATCTCAAC
                      ____________________________________________________________
consensus GTCAACAAGATTACCTCAACTCTTAAAAAGGGAGGGTGGCTTAGTGACAATGATCTCAAC
 
. : . : . : . : . : . :
rJMFF013P22+ CGAGACAGGCTAGACCTGTTCTATTGGCTGTTAGCTGCTCTTAGCCTCATCAACTTCTTT
rJMFF025M11+ CGAGACAGGCTAGACCTGTTCTATTGGCTGTTAGCTGCTCTTAGCCTCATCAACTTCTTT
                      ____________________________________________________________
consensus CGAGACAGGCTAGACCTGTTCTATTGGCTGTTAGCTGCTCTTAGCCTCATCAACTTCTTT
 
. : . : . : . : . : . :
rJMFF013P22+ AACTATCTTTTCTGCTCCAGATGGTATTCTTACAACCCCTCGGTATCCCCAGCCGCCGCC
rJMFF025M11+ AACTATCTTTTCTGCTCCAGATGGTATTCTTACAACCCCTCGGTATCCCCAGCCGCCGCC
                      ____________________________________________________________
consensus AACTATCTTTTCTGCTCCAGATGGTATTCTTACAACCCCTCGGTATCCCCAGCCGCCGCC
 
. : . : . : . : . : . :
rJMFF013P22+ CTAAACCAACCTCAGCCTCGGGACTTAGAGACTGCAAATTCTAACTCTTTGTAATGGATA
rJMFF025M11+ CTAAACCAACCTCAGCCTCGGGACTTAGAGACTGCAAATTCTAACTCTTTGTAATGGATA
                      ____________________________________________________________
consensus CTAAACCAACCTCAGCCTCGGGACTTAGAGACTGCAAATTCTAACTCTTTGTAATGGATA
 
. : . : . : . : . : . :
rJMFF013P22+ TGCAGATGGAAAGCTAACTGAACACATTAGGATCTGATTTCTAGCTAGCATTATCTGTCA
rJMFF025M11+ TGCAGATGGAAAGCTAACTGAACACATTAGGATCTGATTTCTAGCTAGCATTATCTGTCA
                      ____________________________________________________________
consensus TGCAGATGGAAAGCTAACTGAACACATTAGGATCTGATTTCTAGCTAGCATTATCTGTCA
 
. : . : . : . : . : . :
rJMFF013P22+ AAAAAGTTTGTAAGATGATTACTACTACTACTACTGCTATGTAGACTTGATCAGGGTGGT
rJMFF025M11+ AAAAAGTTTGTAAGATGATTACTACTACTACTACTGCTATGTAGACTTGATCAGGGTGGT
                      ____________________________________________________________
consensus AAAAAGTTTGTAAGATGATTACTACTACTACTACTGCTATGTAGACTTGATCAGGGTGGT
 
. : . : . : . : . : . :
rJMFF013P22+ GTGTTATAGTGCAGCATTAATAATTGACAGTGTGTGTGTGTGTGTGTGACATGGACACAC
rJMFF025M11+ GTGTTATAGTGCAGCATTAATAATTGACAGTGTGTGTGTGTGTGTGTGACATGGACACAC
                      ____________________________________________________________
consensus GTGTTATAGTGCAGCATTAATAATTGACAGTGTGTGTGTGTGTGTGTGACATGGACACAC
 
. : . : . : . : . : . :
rJMFF013P22+ AAGACTCCCTTGATGGGCAAGGGTGAAAAGAAAGTTAGGTCTAAGAGTCTAAGACTATCA
rJMFF025M11+ AAGACTCCCTTGATGGGCAAGGGTGAAAAGAAAGTTAGGTCTAAGAGTCTAAGACTATCA
                      ____________________________________________________________
consensus AAGACTCCCTTGATGGGCAAGGGTGAAAAGAAAGTTAGGTCTAAGAGTCTAAGACTATCA
 
. : . : . : . : . : . :
rJMFF013P22+ ACAACAAGATTCATGGTATTGTCGGGCCCGGATGTGGAGCTCTTGGGGTCAGGGATTTTG
rJMFF025M11+ ACAACAAGATTCATGGTATTGTCGGGCCCGGATGTGGAGCTCTTGGGGTCAGGGATTTTG
                      ____________________________________________________________
consensus ACAACAAGATTCATGGTATTGTCGGGCCCGGATGTGGAGCTCTTGGGGTCAGGGATTTTG
 
. : . : . : . : . : . :
rJMFF013P22+ CCTTTTGTGTGGCAAGATTCATGGTATTCTAGCTTCATCCTTGATTCATTTCTCCACAAA
rJMFF025M11+ CCTTTTGTGTGGCAAGATTCATGGTATTCTAGCTTCATCCTTGATTCATTTCTCCACAAA
                      ____________________________________________________________
consensus CCTTTTGTGTGGCAAGATTCATGGTATTCTAGCTTCATCCTTGATTCATTTCTCCACAAA
 
. : . : . : . : . : . :
rJMFF013P22+ CATAGTGTAAAAAACACAAAAAGAGGGTCATGGGGTTTGGTCTCTCTCCCCTTTCTAGTA
rJMFF025M11+ CATAGTGTAAAAAACACAAAAAGAGGGTCATGGGGTTTGGTCTCTCTCCCCTTTCTAGTA
                      ____________________________________________________________
consensus CATAGTGTAAAAAACACAAAAAGAGGGTCATGGGGTTTGGTCTCTCTCCCCTTTCTAGTA
 
. : . : . : . : . : . :
rJMFF013P22+ GAAAGAATTGCAGAGAAATATTGAGTGGTGGGGTTGAGCTTTAT
rJMFF025M11+ GAAAGAATTGCAGAGAAATATTGAGTGGTGGGGTTGAGCTTTATGCTTTAATTAAAGGGA
                      ____________________________________________________________
consensus GAAAGAATTGCAGAGAAATATTGAGTGGTGGGGTTGAGCTTTATGCTTTAATTAAAGGGA