Previous Contig 009411:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003N05Sequence587009411 (6)gb:AJ871961_18151117e-78Phaseolus vulgaris var. nanus mRNA for triose-phosphate isomerase (tpi gene).744009411 (6)gb:AP003241_18260793e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMFF025M06Sequence568009411 (6)gb:AJ871961_18151117e-75Phaseolus vulgaris var. nanus mRNA for triose-phosphate isomerase (tpi gene).743009411 (6)gb:AP003241_18260792e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF009B17Sequence437009411 (6)gb:AY631048_16186845e-42Glycine max triosephosphate isomerase mRNA, complete cds.
JMSF030A18Sequence686009411 (6)gb:AJ871961_18151117e-84Phaseolus vulgaris var. nanus mRNA for triose-phosphate isomerase (tpi gene).765023423gb:AY438596_16062571e-33Solanum chacoense triose phosphate isomerase cytosolic isoform mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030A18- GGTATATTGTCGATCTCTC
                      ____________________________________________________________
consensus GGTATATTGTCGATCTCTC
 
. : . : . : . : . : . :
JMFF025M06- GAACCCTTAATTGTAAAAATGGGCAGAAAGTTCTTCGTCGGTG
JMFF003N05- GAACCCTTAATTGTAAAAATGGGCAGAAAGTTCTTCGTCGGTG
JMSF030A18- GGTGTCTTCACGCAGTGGAACCCTTAATTGTAAAAATGGGCAGAAAGTTCTTCGTCGGTG
                      ____________________________________________________________
consensus GGTGTCTTCACGCAGTGGAACCCTTAATTGTAAAAATGGGCAGAAAGTTCTTCGTCGGTG
 
. : . : . : . : . : . :
JMFF025M06- GTAACTGGAAATGCAATGGAACCACTGAGGAGGTGAAGAAGATTGTGACCACATTGAATG
JMFF003N05- GTAACTGGAAATGCAATGGAACCACTGAGGAGGTGAAGAAGATTGTGACCACATTGAATG
JMSF030A18- GTAACTGGAAATGCAATGGAACCACTGAGGAGGTGAAGAAGATTGTGACCACATTGAATG
                      ____________________________________________________________
consensus GTAACTGGAAATGCAATGGAACCACTGAGGAGGTGAAGAAGATTGTGACCACATTGAATG
 
. : . : . : . : . : . :
JMFF025M06- AAGCTGAAGTTCCATCGGAAGATGATGTTGAGGTTGTGGTCAGTCCTCCTTTTGTGTTTC
JMFF003N05- AAGCTGAAGTTCCATCGGAAGATGATGTTGAGGTTGTGGTCAGTCCTCCTTTTGTGTTTC
JMSF030A18- AAGCTGAAGTTCCATCGGAAGATGATGTTGAGGTTGTGGTCAGTCCTCCTTTTGTGTTTC
                      ____________________________________________________________
consensus AAGCTGAAGTTCCATCGGAAGATGATGTTGAGGTTGTGGTCAGTCCTCCTTTTGTGTTTC
 
. : . : . : . : . : . :
JMFF025M06- TTCCTTTGGTCAAAACCTTATTGCGTCCTGATTTCTCTATTGCTGCCCAGAACTGTTGGG
JMFF003N05- TTCCTTTGGTCAAAACCTTATTGCGTCCTGATTTCTCTATTGCTGCCCAGAACTGTTGGG
JMSF030A18- TTCCTTTGGTCAAAACCTTATTGCGTCCTGATTTCTCTATTGCTGCCCAGAACTGTTGGG
rJMFF003N05+ CTCTATTGCTGCCCAGAACTGTTGGG
rJMFF025M06+ CTATTGCTGCCCAGAACTGTTGGG
                      ____________________________________________________________
consensus TTCCTTTGGTCAAAACCTTATTGCGTCCTGATTTCTCTATTGCTGCCCAGAACTGTTGGG
 
. : . : . : . : . : . :
JMFF025M06- TTCGAAAAGGAGGTGC-TTTTACTGGTGAAATTAGTGTTGAGATGCTGATAAATTTGGGC
JMFF003N05- TTCGAAAAGGAGGTGC-TTTTACTGGTGAAATTAGTGTTGAGATGCTGATAAATTTGGGC
JMSF030A18- TTCGAAAAGGAGGTGC-TTTTACTGGTGAAATTAGTGTTGAGATGCTGATAAATTTGGGC
rJMFF003N05+ TTCGAAAAGGAGGTGCTTTTTACTGGTGAAATTAGTGTTGAGATGCTGATAAATTTGGGC
rJMFF025M06+ TTCGAAAAGGAGGTGC-TTTTACTGGTGAAATTAGTGTTGAGATGCTGATAAATTTGGGC
                      ____________________________________________________________
consensus TTCGAAAAGGAGGTGC-TTTTACTGGTGAAATTAGTGTTGAGATGCTGATAAATTTGGGC
 
. : . : . : . : . : . :
JMFF025M06- ATTCCATGGGTCATCCTTGGCCATTCGGAGAGAAGACAACTACTGAATGAATCAAATGAT
JMFF003N05- ATTCCATGGGTCATCCTTGGCCATTCGGAGAGAAGACAACTACTGAATGAATCAAATGAT
JMSF030A18- ATTCCATGGGTCATCCTTGGCCATTCGGAGAGAAGACAACTACTGAATGAATCAAATGAT
rJMFF003N05+ ATTCCATGGGTCATCCTTGGCCATTCGGAGAGAAGACAACTACTGAATGAATCAAATGAT
rJMFF025M06+ ATTCCATGGGTCATCCTTGGCCATTCGGAGAGAAGACAACTACTGAATGAATCAAATGAT
                      ____________________________________________________________
consensus ATTCCATGGGTCATCCTTGGCCATTCGGAGAGAAGACAACTACTGAATGAATCAAATGAT
 
. : . : . : . : . : . :
JMFF025M06- TTTGTAGCAGATAAAGTTGCATATGCACTTTCCCAAGGCATAAAAGTCATTGCTTGTGTT
JMFF003N05- TTTGTAGCAGATAAAGTTGCATATGCACTTTCCCAAGGCATAAAAGTCATTGCTTGTGTT
JMSF030A18- TTTGTAGCAGATAAAGTTGCATATGCACTTTCCCAAGGCATAAAAGTCATTGCTTGTGTT
rJMSF009B17+ AGGCATAAAAGTCATTGCTTGTGTT
rJMFF003N05+ TTTGTAGCAGATAAAGTTGCATATGCACTTTCCCAAGGCATAAAAGTCATTGCTTGTGTT
rJMFF025M06+ TTTGTAGCAGATAAAGTTGCATATGCACTTTCCCAAGGCATAAAAGTCATTGCTTGTGTT
                      ____________________________________________________________
consensus TTTGTAGCAGATAAAGTTGCATATGCACTTTCCCAAGGCATAAAAGTCATTGCTTGTGTT
 
. : . : . : . : . : . :
JMFF025M06- GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAATGGAAGTAGTTGCCGCCCAAACA
JMFF003N05- GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAATGGAAGTAGTTGCCGCCCAAACA
JMSF030A18- GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAATGGAAGTAGTTGCCGCCCAAACA
rJMSF009B17+ GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAACGGAAGTAGTTGCCGCCCAAACA
rJMFF003N05+ GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAATGGAAGTAGTTGCCGCCCAAACA
rJMFF025M06+ GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAATGGAAGTAGTTGCCGCCCAAACA
                      ____________________________________________________________
consensus GGAGAGACTCTTGAGCAGAGAGAATCAGGGGCTACAATGGAAGTAGTTGCCGCCCAAACA
 
. : . : . : . : . : . :
JMFF025M06- AAAGCAATTGCAGAGAAGGTCTCAAATTGGTCCAGCATTGTTTTGGCTTATGAGCCTGTT
JMFF003N05- AAAGCAATTGCAGAGAAGGTCTCAAATTGGTCCAGCATTGTTTTGGCTTATGAGCCTGTT
JMSF030A18- AAAGCAATTGC-----AGGTCTCAAATTGGTCCAGCATTGTTTTGGCTTATGAGCCTGTT
rJMSF009B17+ ANAGCAATTGCNGAGAAGGTCTCAANTTGGTCCANCNTTGNTTTGGCTTATGAGCCTGTN
rJMFF003N05+ AAAGCAATTGCAGAGAAGGTCTCAAATTGGTCCAGCATTGTTTTGGCTTATGAGCCTGTT
rJMFF025M06+ AAAGCAATTGCAGAGAAGGTCTCAAATTGGTCCAGCATTGTTTTGGCTTATGAGCCTGTT
                      ____________________________________________________________
consensus AAAGCAATTGCAGAGAAGGTCTCAAATTGGTCCAGCATTGTTTTGGCTTATGAGCCTGTT
 
. : . : . : . : . : . :
JMFF025M06- TGGGCCATTGGTACTGGAAAGGTCGCCACTCCTGCTCAGG
JMFF003N05- TGGGCCATTGGTACTGGAAAGGTCGCCACTCCTGCTCAGGCTCAAGAAGTTCATTCTGAA
JMSF030A18- TGGGCCATTGGTACTGGAAAGGTCGCCACTCCTGCTCAGGCTCAAGAAGTTCATTCTGAA
rJMSF009B17+ NGGGCCANTGNTNCTGGAAAGGTCGCCACTCNTGCTCAGGCTCAAGAAGTTCATTNTGAA
rJMFF003N05+ TGGGCCATTGGTACTGGAAAGGTCGCCACTCCTGCTCAGGCTCAAGAAGTTCATTCTGAA
rJMFF025M06+ TGGGCCATTGGTACTGGAAAGGTCGCCACTCCTGCTCAGGCTCAAGAAGTTCATTCTGAA
                      ____________________________________________________________
consensus TGGGCCATTGGTACTGGAAAGGTCGCCACTCCTGCTCAGGCTCAAGAAGTTCATTCTGAA
 
. : . : . : . : . : . :
JMFF003N05- C
JMSF030A18- CTGAGAAAATGGCTTCATGACAATGTTGGCCCAGAAGTTGCTGCTTCTACTAGGATCATC
rJMSF009B17+ CTGAGAAAANGGNTTCATGACAATGTTGGNCCAGAAGTTGNTGCTTGTATTAGGATCATC
rJMFF003N05+ CTGAGAAAATGGCTTCATGACAATGTTGGCCCAGAAGTTGCTGCTTCTACTAGGATCATC
rJMFF025M06+ CTGAGAAAATGGCTTCATGACAATGTTGGCCCAGAAGTTGCTGCTTCTACTAGGATCATC
                      ____________________________________________________________
consensus CTGAGAAAATGGCTTCATGACAATGTTGGCCCAGAAGTTGCTGCTTCTACTAGGATCATC
 
. : . : . : . : . : . :
JMSF030A18- TATGGAGGT
rJMSF009B17+ TATGGAGGT
rJMFF003N05+ TATGGAGGTTCTGTCAATGGAGCAAACTGCAAAGAGTTGGCAACAAAGCCTGACGTGGAT
rJMFF025M06+ TATGGAGGTTCTGTCAATGGAGCAAACTGCAAAGAGTTGGCAACAAAGCCTGACGTGGAT
                      ____________________________________________________________
consensus TATGGAGGTTCTGTCAATGGAGCAAACTGCAAAGAGTTGGCAACAAAGCCTGACGTGGAT
 
. : . : . : . : . : . :
rJMFF003N05+ GGGTTTTTGGTTGGTGGTGCCTCTCTAAAGCCCGAGTTCATTGAGATTATCAAGTCTGCA
rJMFF025M06+ GGGTTTTTGGTTGGTGGTGCCTCTCTAAAGCCCGAGTTCATTGAGATTATCAAGTCTGCA
                      ____________________________________________________________
consensus GGGTTTTTGGTTGGTGGTGCCTCTCTAAAGCCCGAGTTCATTGAGATTATCAAGTCTGCA
 
. : . : . : . : . : . :
rJMFF003N05+ ACTGTGAAACAGAGCACTTGAAGATGATTGCAGGTATATGGATACACGCAAGTGATGCTT
rJMFF025M06+ ACTGTGAAACAGAGCACTTGAAGATGATTGCAGGTATATGGATACACGCAAGTGATGCTT
                      ____________________________________________________________
consensus ACTGTGAAACAGAGCACTTGAAGATGATTGCAGGTATATGGATACACGCAAGTGATGCTT
 
. : . : . : . : . : . :
rJMFF003N05+ TTACCGTTGTTTTTGCTACAGGAATGTGTTTCTGGTTTGTGTTTGACCCAGGGTTTCTTG
rJMFF025M06+ TTACCGTTGTTTTTGCTACAGGAATGTGTTTCTGGTTTGTGTTTGACCCAGGGTTTCTTG
                      ____________________________________________________________
consensus TTACCGTTGTTTTTGCTACAGGAATGTGTTTCTGGTTTGTGTTTGACCCAGGGTTTCTTG
 
. : . : . : . : . : . :
rJMFF003N05+ TCTTGTAAAATAAACGAGAGATATTTACTAAGCTCGTTCTTTTGATCTAAGAAAAAAC
rJMFF025M06+ TCTTGTAAAATAAACGAGAGATATTTACTAAGCTCGTTCTTTTGATCTAAGAAAAAACTA
                      ____________________________________________________________
consensus TCTTGTAAAATAAACGAGAGATATTTACTAAGCTCGTTCTTTTGATCTAAGAAAAAACTA