Previous Contig 009408:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006I02Sequence412000328 (3)gb:AY049233_15618769e-05Arabidopsis thaliana AT5g35560/MOK9_21 mRNA, complete cds.>gb:BT000590_1634868 A683009408 (4)gb:AP004140_18381811e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15
JMFF022B20Sequence686009408 (4)gb:AP004140_18381812e-84Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15
JMFF025L12Sequence618000328 (3)gb:AB015477_15126341e-33Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOK9.753009408 (4)gb:AP004140_18381811e-92Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15
JMSF001H07Sequence366000328 (3)764009408 (4)gb:AP004140_1838181e-100Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001H07+ GGGCCATTGCATGTTTATGTGGTTCC
                      ____________________________________________________________
consensus GGGCCATTGCATGTTTATGTGGTTCC
 
. : . : . : . : . : . :
rJMSF001H07+ TTGCGTCTGGAGCATGTCTTAACTTTGTTCGCAGGGGCTCTCTTGGAGAAGCAAGTTGTA
rJMFF025L12+ TTCGCAGGGGCTCTCTTGGAGAAGCAAGTTGTA
                      ____________________________________________________________
consensus TTGCGTCTGGAGCATGTCTTAACTTTGTTCGCAGGGGCTCTCTTGGAGAAGCAAGTTGTA
 
. : . : . : . : . : . :
rJMSF001H07+ GTAGTTTGTTCGAATTTGGGCATATTATCTGCTTGCATTATGGCCATTATTCCACTGATT
rJMFF022B20+ TGGGCATATTATCTGCTTGCATTATGGCCATTATTCCACTGATT
rJMFF006I02+ TGGGCATATTATCTGCTTGCATTATGGCCATTATTCCACTGATT
rJMFF025L12+ GTAGTTTGTTCGAATTTGGGCATATTATCTGCTTGCATTATGGCCATTATTCCACTGATT
                      ____________________________________________________________
consensus GTAGTTTGTTCGAATTTGGGCATATTATCTGCTTGCATTATGGCCATTATTCCACTGATT
 
. : . : . : . : . : . :
rJMSF001H07+ CGTCCCTACCAGTGGCAGAGCTTGTTAATGCCGGTTTTGCCAAATGATATGTTGGACTTT
rJMFF022B20+ CGTCCCTACCAGTGGCAGAGCTTGTTAATGCCGGTTTTGCCAAATGATATGTTGGACTTT
rJMFF006I02+ CGTCCCTACCAGTGGCAGAGCTTGTTAATGCCGGTTTTGCCAAATGATATGTTGGACTTT
rJMFF025L12+ CGTCCCTACCAGTGGCAGAGCTTGTTAATGCCGGTTTTGCCAAATGATATGTTGGACTTT
                      ____________________________________________________________
consensus CGTCCCTACCAGTGGCAGAGCTTGTTAATGCCGGTTTTGCCAAATGATATGTTGGACTTT
 
. : . : . : . : . : . :
rJMSF001H07+ TTGGATGCACCTGTTCCCTATATTGTAGGCGTAAAGAACAAAAACTCTGAATTGCAGTCG
rJMFF022B20+ TTGGATGCACCTGTTCCCTATATTGTAGGCGTAAAGAACAAAAACTCTGAATTGCAGTCG
rJMFF006I02+ TTGGATGCACCTGTTCCCTATATTGTAGGCGTAAAGAACAAAAACTCTGAATTGCAGTCG
rJMFF025L12+ TTGGATGCACCTGTTCCCTATATTGTAGGCGTAAAGAACAAAAACTCTGAATTGCAGTCG
                      ____________________________________________________________
consensus TTGGATGCACCTGTTCCCTATATTGTAGGCGTAAAGAACAAAAACTCTGAATTGCAGTCG
 
. : . : . : . : . : . :
rJMSF001H07+ AAGTTAACAAATGTTGTTCTTGTAGATGTGAACAAGAATCAGATGAAGTCGCATTCAATA
rJMFF022B20+ AAGTTAACAAATGTTGTTCTTGTAGATGTGAACAAGAATCAGATGAAGTCGCATTCAATA
rJMFF006I02+ AAGTTAACAAATGTTGTTCTTGTAGATGTGAACAAGAATCAGATGAAGTCGCATTCAATA
rJMFF025L12+ AAGTTAACAAATGTTGTTCTTGTAGATGTGAACAAGAATCAGATGAAGTCGCATTCAATA
                      ____________________________________________________________
consensus AAGTTAACAAATGTTGTTCTTGTAGATGTGAACAAGAATCAGATGAAGTCGCATTCAATA
 
. : . : . : . : . : . :
rJMSF001H07+ CCACAATTACCCCAACAAAAGGAACTATACGCATCCTTAATTTCGTACCATGGAAAACTT
rJMFF022B20+ CCACAATTACCCCAACAAAAGGAACTATACGCATCCTTAATTTCGTACCATGGAAAACTT
rJMFF006I02+ CCACAATTACCCCAACAAAAGGAACTATACGCATCCTTAATTTCGTACCATGGAAAACTT
rJMFF025L12+ CCACAATTACCCCAACAAAAGGAACTATACGCATCCTTAATTTCGTACCATGGAAAACTT
                      ____________________________________________________________
consensus CCACAATTACCCCAACAAAAGGAACTATACGCATCCTTAATTTCGTACCATGGAAAACTT
 
. : . : . : . : . : . :
rJMSF001H07+ GTGGGAGAGAGTTTCTTGGGAAAGAAAAGGCCAGTTTATGAGTGTACTGATGTGCAGGCT
rJMFF022B20+ GTGGGAGAGAGTTTCTTGGGAAAGAAAAGGCCAGTTTATGAGTGTACTGATGTGCAGGCT
rJMFF006I02+ GTGGGAGANAGTTTCTTGGGAAAGAAAAGGCCAGTTTATGAGTGTACTGATGTGCAGGCT
rJMFF025L12+ GTGGGAGAGAGTTTCTTGGGAAAGAAAAGGCCAGTTTATGAGTGTACTGATGTGCAGGCT
                      ____________________________________________________________
consensus GTGGGAGAGAGTTTCTTGGGAAAGAAAAGGCCAGTTTATGAGTGTACTGATGTGCAGGCT
 
. : . : . : . : . : . :
rJMSF001H07+ GAAGCTGCTAAGGGTTTCCTAAGAGTGCTGCGGTCTTACCTGGATTCACTTTGTTCTAGT
rJMFF022B20+ GAAGCTGCTAAGGGTTTCCTAAGAGTGCTGCGGTCTTACCTGGATTCACTTTGTTCTAGT
rJMFF006I02+ GAAGCTGCTAAGGGTTTCCTAAGAGTGCTGCGGTCTTACCTGGATTCACTTTGTTCTAGT
rJMFF025L12+ GAAGCTGCTAAGGGTTTCCTAAGAGTGCTGCGGTCTTACCTGGATTCACTTTGTTCTAGT
                      ____________________________________________________________
consensus GAAGCTGCTAAGGGTTTCCTAAGAGTGCTGCGGTCTTACCTGGATTCACTTTGTTCTAGT
 
. : . : . : . : . : . :
rJMSF001H07+ CTTCGCTGTCACACAATTACCAATGTTCAATCAAATAATGATAAGGTATCATTGCTCTTG
rJMFF022B20+ CTTCGCTGTCACACAATTACCAATGTTCAATCAAATAATGATAAGGTATCATTGCTCTTG
rJMFF006I02+ CTTCGCTGTCACACAATTACCAATGTTCAATCAAATAATGATAAGGTATCATTGCTCTTG
rJMFF025L12+ CTTCGCTGTCACACAATTACCAATGTTCAATCAAATAATGATAAGGTATCATTGCTCTTG
                      ____________________________________________________________
consensus CTTCGCTGTCACACAATTACCAATGTTCAATCAAATAATGATAAGGTATCATTGCTCTTG
 
. : . : . : . : . : . :
rJMSF001H07+ AAGGACAGTTTCATCGAATCTTTCCCCTATCGAGATCGACCTTTTATGAAGCTCTTCGTG
rJMFF022B20+ AAGGACAGTTTCATCGAATCTTTCCCCTATCGAGATCGACCTTTTATGAAGCTCTTCGTG
rJMFF006I02+ AAGGACAGTTTCATCGAATCTTTCCCCTATCGAGATCGACCTTTTATGAAGCTCTTCGTG
rJMFF025L12+ AAGGACAGTTTCATCGAATCTTTCCCCTATCGAGATCGACCTTTTATGAAGCTCTTCGTG
                      ____________________________________________________________
consensus AAGGACAGTTTCATCGAATCTTTCCCCTATCGAGATCGACCTTTTATGAAGCTCTTCGTG
 
. : . : . : . : . : . :
rJMSF001H07+ GACACACAACTCTTCTCCGTACATACAGATTTTGTACTTTCTTTCTTCCAAAAAGAATAG
rJMFF022B20+ GACACACAACTCTTCTCCGTACATACAGATTTTGTACTTTCTTTCTTCCAAAAAGAATAG
rJMFF006I02+ GACACACAACTCTTCTCCGTACATACAGATTTTGTACTTTCTTTCTTCCAAAAAGAATAG
rJMFF025L12+ GACACACAACTCTTCTCCGTACATACAGATTTTGTACTTTCTTTCTTCCAAAAAGAATAG
                      ____________________________________________________________
consensus GACACACAACTCTTCTCCGTACATACAGATTTTGTACTTTCTTTCTTCCAAAAAGAATAG
 
. : . : . : . : . : . :
rJMSF001H07+ GGCGATGTACAAGGTTGTTTGGCAGTGTGACAGTGGAACGCAAGTTCTATTGCAATCTGT
rJMFF022B20+ GGCGATGTACAAGGTTGTTTGGCAGTGTGACAGTGGAACGCAAGTTCTATTGCAATCTGT
rJMFF006I02+ GGCGATGTACAAGGTTGTTTGGCAGTGTGACAGTGGAACGCAAGTTCTATTGCAATCTGT
rJMFF025L12+ GGCGATGTACAAGGTTGTTTGGCAGTGTGACAGTGGAACGCAAGTTCTATTGCAATCTGT
                      ____________________________________________________________
consensus GGCGATGTACAAGGTTGTTTGGCAGTGTGACAGTGGAACGCAAGTTCTATTGCAATCTGT
 
. : . : . : . : . : . :
rJMSF001H07+ ATTATCATTATATGATTA
rJMFF022B20+ ATTATCATTATATGATTAGTATTAGTATTATTCTTAACA
rJMFF006I02+ ATTATCATTATATGATTAGTATTAGTATTATTCTTAACA
rJMFF025L12+ ATTATCATTATATGATTAGTATTAGTATTATTCTTAACATAAAATTTTTGTTTAATCATA
                      ____________________________________________________________
consensus ATTATCATTATATGATTAGTATTAGTATTATTCTTAACATAAAATTTTTGTTTAATCATA