Previous Contig 009406:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003H23Sequence715009406 (36)gb:PHGLSTRAN_17001212e-81P.hybrida mRNA for glutathione S-transferase.
JMFF009G08Sequence613009406 (36)gb:PHGLSTRAN_17001215e-72P.hybrida mRNA for glutathione S-transferase.715009406 (36)gb:PHGLSTRAN_17001218e-86P.hybrida mRNA for glutathione S-transferase.
JMFF014J10Sequence540009406 (36)gb:PHGLSTRAN_17001212e-59P.hybrida mRNA for glutathione S-transferase.782009406 (36)gb:PHGLSTRAN_17001211e-90P.hybrida mRNA for glutathione S-transferase.
JMFF016C12Sequence570009406 (36)gb:PHGLSTRAN_17001215e-63P.hybrida mRNA for glutathione S-transferase.776009406 (36)gb:PHGLSTRAN_17001211e-88P.hybrida mRNA for glutathione S-transferase.
JMFF017N21Sequence529009406 (36)gb:PHGLSTRAN_17001214e-57P.hybrida mRNA for glutathione S-transferase.777009406 (36)gb:PHGLSTRAN_17001219e-91P.hybrida mRNA for glutathione S-transferase.
JMFF023P11Sequence444009406 (36)gb:PHGLSTRAN_17001212e-47P.hybrida mRNA for glutathione S-transferase.
JMFF024K15Sequence481009406 (36)gb:PHGLSTRAN_17001212e-52P.hybrida mRNA for glutathione S-transferase.771009406 (36)gb:PHGLSTRAN_17001213e-86P.hybrida mRNA for glutathione S-transferase.
JMFF025K14Sequence539009406 (36)gb:PHGLSTRAN_17001212e-59P.hybrida mRNA for glutathione S-transferase.758009406 (36)gb:PHGLSTRAN_17001214e-91P.hybrida mRNA for glutathione S-transferase.
JMFF029B11Sequence562009406 (36)gb:PHGLSTRAN_17001217e-63P.hybrida mRNA for glutathione S-transferase.717009406 (36)gb:PHGLSTRAN_17001213e-87P.hybrida mRNA for glutathione S-transferase.
JMFF043D12Sequence597009406 (36)gb:PHGLSTRAN_17001211e-67P.hybrida mRNA for glutathione S-transferase.611009406 (36)gb:PHGLSTRAN_17001212e-85P.hybrida mRNA for glutathione S-transferase.
JMFF045F01Sequence632006457 (2)pir|F84668|F846682e-14hypothetical protein At2g27090 [imported] - Arabidopsis thaliana>gb:AC005623_153583009406 (36)gb:PHGLSTRAN_17001213e-63P.hybrida mRNA for glutathione S-transferase.
JMFF046F05Sequence597009406 (36)gb:PHGLSTRAN_17001217e-68P.hybrida mRNA for glutathione S-transferase.450009406 (36)gb:PHGLSTRAN_17001214e-49P.hybrida mRNA for glutathione S-transferase.
JMFN008F06Sequence604009406 (36)gb:PHGLSTRAN_17001211e-74P.hybrida mRNA for glutathione S-transferase.
JMFN009E22Sequence611009406 (36)gb:PHGLSTRAN_17001213e-75P.hybrida mRNA for glutathione S-transferase.
JMFN012N06Sequence556009406 (36)gb:PHGLSTRAN_17001214e-59P.hybrida mRNA for glutathione S-transferase.
JMFN018K20Sequence557009406 (36)gb:PHGLSTRAN_17001212e-69P.hybrida mRNA for glutathione S-transferase.
JMFN031H19Sequence544009406 (36)gb:PHGLSTRAN_17001213e-57P.hybrida mRNA for glutathione S-transferase.
JMFN031L12Sequence608009406 (36)gb:PHGLSTRAN_17001215e-75P.hybrida mRNA for glutathione S-transferase.
JMFN033N20Sequence569009406 (36)gb:PHGLSTRAN_17001213e-68P.hybrida mRNA for glutathione S-transferase.
JMFN037A06Sequence621009406 (36)gb:PHGLSTRAN_17001216e-78P.hybrida mRNA for glutathione S-transferase.
JMFN037C12Sequence604009406 (36)gb:PHGLSTRAN_17001216e-78P.hybrida mRNA for glutathione S-transferase.
JMFN038C20Sequence599009406 (36)gb:PHGLSTRAN_17001213e-75P.hybrida mRNA for glutathione S-transferase.
JMFS146E05Sequence524009406 (36)gb:PHGLSTRAN_17001212e-52P.hybrida mRNA for glutathione S-transferase.
JMSF029K16Sequence662009406 (36)gb:PHGLSTRAN_17001218e-79P.hybrida mRNA for glutathione S-transferase.739009406 (36)gb:PHGLSTRAN_17001211e-89P.hybrida mRNA for glutathione S-transferase.
JMSF035F15Sequence659009406 (36)gb:PHGLSTRAN_17001217e-80P.hybrida mRNA for glutathione S-transferase.741009406 (36)gb:PHGLSTRAN_17001219e-91P.hybrida mRNA for glutathione S-transferase.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN031H19+ GGATGCAAGGATAAGTTTATTAGG
JMFS146E05+ GGATGCAAGGATAAGTTTATTAGG
JMFN012N06+ AGGATGCAAGGATAAGTTTATTAGG
rJMFF045F01- GGATGCAAGGATAAGTTTATTAGG
rJMFF009G08- AGTTTATTAGG
rJMFF003H23- AGTTTATTAGG
rJMFF029B11- AGTTTATTAGG
rJMFF016C12- GTTTATTAGG
rJMFF017N21- GTTTATTAGG
rJMFF014J10- TAGG
                      ____________________________________________________________
consensus AGGATGCAAGGATAAGTTTATTAGG
 
. : . : . : . : . : . :
JMFN031H19+ AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
JMFS146E05+ AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
JMFN012N06+ AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF045F01- AAGGGATAACGTAGAGAAAATATACCAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF009G08- AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF003H23- AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF029B11- AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF016C12- AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF017N21- AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF024K15- AACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMSF029K16- AATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMSF035F15- AATAATAAAACACGAGAAAGGGAAATATAATAAT
rJMFF014J10- AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
                      ____________________________________________________________
consensus AAGGGATAACGTAGAGAAAATATACAAATAATAAAACACGAGAAAGGGAAATATAATAAT
 
. : . : . : . : . : . :
JMFN031H19+ ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
JMFS146E05+ ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF046F05- AAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
JMFN012N06+ ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF045F01- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF009G08- ATAATAAAACTGGATCAATTTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF003H23- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF029B11- ATAATAAAACTGGATCAATTTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF016C12- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF017N21- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF024K15- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMSF029K16- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMSF035F15- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF043D12- GGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF014J10- ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
rJMFF025K14- TTTTTTTGGTT-TTGATGAGGTCCAACACTTTGTTCCAAGC
                      ____________________________________________________________
consensus ATAATAAAACTGGATCAA-TTTTTTTGGTTATTGATGAGGTCCAACACTTTGTTCCAAGC
 
. : . : . : . : . : . :
JMFN031H19+ AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
JMFS146E05+ AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF046F05- AGGCCTGGCAAAAATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
JMFN012N06+ AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF045F01- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF009G08- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF003H23- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF029B11- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF016C12- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF017N21- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF024K15- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMSF029K16- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMSF035F15- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF043D12- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
rJMFF014J10- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
JMSF035F15+ TCACTCACCAAATG
JMSF029K16+ TCACTCACCAAATG
rJMFF025K14- AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
                      ____________________________________________________________
consensus AGGCCTGGCAGAGATGTCGGAATACCAAGCATTCAAACACTTCCTCTCACTCACCAAATG
 
. : . : . : . : . : . :
JMFN031H19+ CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFS146E05+ CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF046F05- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN012N06+ CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF045F01- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF009G08- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF003H23- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF029B11- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF016C12- CCCAAAACCACCTTAGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF017N21- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF024K15- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMSF029K16- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMSF035F15- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF043D12- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
rJMFF014J10- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMSF035F15+ CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFF046F05+ GATCAGCCAA
JMFF043D12+ GATCAGCCAA
JMFN033N20+ CAGCCAA
JMFN018K20+ AAGATCAGCCAA
JMFF009G08+ CTGGGGAGGTGGCTAAGATCAGCCAA
JMSF029K16+ CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN037A06+ AAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN038C20+ CGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN031L12+ CGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN009E22+ CGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN037C12+ CAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
JMFN008F06+ GGTCAAGAATCTGAGGCTGGGNAGGTGGCTAAGATCAGCCAA
rJMFF025K14- CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
                      ____________________________________________________________
consensus CCCAAAACCACCTTCGTTGGTCAAGAATCTGAGGCTGGGGAGGTGGCTAAGATCAGCCAA
 
. : . : . : . : . : . :
JMFN031H19+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFS146E05+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF046F05- GGAGAAAAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN012N06+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF045F01- GGAGAAGAAATCTCAGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF009G08- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF003H23- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF029B11- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF016C12- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF017N21- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF024K15- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMSF029K16- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMSF035F15- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF043D12- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGACCAA
rJMFF014J10- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMSF035F15+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFF046F05+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCTTTTCTTCATAAACGTCCAA
JMFF043D12+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTGNAAAGCCTTTCTTCATAAACGTCCAA
JMFN033N20+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFF016C12+ CCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFF029B11+ TATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN018K20+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFF014J10+ CTTCATAAACGTCCAA
JMFF025K14+ TTCATAAACGTCCAA
JMFF017N21+ CCAA
JMFF009G08+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMSF029K16+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN037A06+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN038C20+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN031L12+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN009E22+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
JMFN037C12+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTGGAAAGCCTTTCTTCATAAACGTCCAA
JMFN008F06+ GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
rJMFF025K14- GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
                      ____________________________________________________________
consensus GGAGAAGAAATCTCCGGCCAGGTATTTGCTCTTTGAAAGCCTTTCTTCATAAACGTCCAA
 
. : . : . : . : . : . :
JMFN031H19+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFS146E05+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF046F05- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN012N06+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF045F01- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF009G08- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF003H23- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF029B11- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF016C12- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF017N21- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF024K15- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMSF029K16- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMSF035F15- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF043D12- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF014J10- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMSF035F15+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF046F05+ CACTTTCCCCAGCTNTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF043D12+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN033N20+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF016C12+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF029B11+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN018K20+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF014J10+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF025K14+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF017N21+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFF024K15+ CGCTGGGCTGTCCCAT
JMFF009G08+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMSF029K16+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN037A06+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN038C20+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN031L12+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGAGCTGTCCCAT
JMFN009E22+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN037C12+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
JMFN008F06+ CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
rJMFF025K14- CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
                      ____________________________________________________________
consensus CACTTTCCCCAGCTTTTCTGCACATTTCTTCACCACACTCATGTCGCTGGGCTGTCCCAT
 
. : . : . : . : . : . :
JMFN031H19+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFS146E05+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF046F05- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAAACTAGGTCGTTGTAGTTGTTGGA
JMFN012N06+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF045F01- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF009G08- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF003H23- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF029B11- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF016C12- GCTGGGGAACACAAACATCTGAAGAACCATGATGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF017N21- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF024K15- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMSF029K16- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMSF035F15- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF043D12- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF014J10- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMSF035F15+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF046F05+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF043D12+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN033N20+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF016C12+ GCTGGGGAACACAAACATCTGAAGAACCATGATGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF029B11+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN018K20+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF014J10+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF025K14+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF017N21+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF024K15+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF023P11+ AAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFF009G08+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMSF029K16+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN037A06+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN038C20+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN031L12+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN009E22+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN037C12+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
JMFN008F06+ GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
rJMFF025K14- GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
                      ____________________________________________________________
consensus GCTGGGGAACACAAACATCTGAAGAACCATGTTGTAGACTAGGTCGTTGTAGTTGTTGGA
 
. : . : . : . : . : . :
JMFN031H19+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFS146E05+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF046F05- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTT
JMFN012N06+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF045F01- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF009G08- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF003H23- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF029B11- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF016C12- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF017N21- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF024K15- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMSF029K16- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMSF035F15- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF043D12- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF014J10- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMSF035F15+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF046F05+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF043D12+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN033N20+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF016C12+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF029B11+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN018K20+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF014J10+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF025K14+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF017N21+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF024K15+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF023P11+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFF009G08+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMSF029K16+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN037A06+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN038C20+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN031L12+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN009E22+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN037C12+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
JMFN008F06+ TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
rJMFF025K14- TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
                      ____________________________________________________________
consensus TTCCACTTCTAGCCATTGATCCACCACGCCTCTCTCTTCGACCGTCTTTCCCATTAGGTT
 
. : . : . : . : . : . :
JMFN031H19+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATG
JMFS146E05+ CT
JMFN012N06+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGAT
rJMFF045F01- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF009G08- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF003H23- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF029B11- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF016C12- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF017N21- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF024K15- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMSF029K16- CTTGCCTTTTTCTGCATATTTTGTTGCGCAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMSF035F15- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF043D12- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF014J10- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMSF035F15+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF046F05+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF043D12+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN033N20+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF016C12+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF029B11+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN018K20+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF014J10+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF025K14+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF017N21+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF024K15+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF023P11+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFF009G08+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMSF029K16+ CTTGCCTTTTTCTGCATATTTTGTTGCGCAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN037A06+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN038C20+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN031L12+ ATTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN009E22+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN037C12+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
JMFN008F06+ CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
rJMFF025K14- CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
                      ____________________________________________________________
consensus CTTGCCTTTTTCTGCATATTTTGTTGCGTAGTACCTTATGATCGCCCTGGATTCGAAAAG
 
. : . : . : . : . : . :
rJMFF045F01- CTTGAAGTCTCCATCCTCA
rJMFF009G08- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF003H23- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF029B11- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF016C12- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF017N21- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF024K15- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMSF029K16- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMSF035F15- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF043D12- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF014J10- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMSF035F15+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF046F05+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF043D12+ CTTAACGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN033N20+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF016C12+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF029B11+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN018K20+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF014J10+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF025K14+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF017N21+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF024K15+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF023P11+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFF009G08+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMSF029K16+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN037A06+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN038C20+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN031L12+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN009E22+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN037C12+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
JMFN008F06+ CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
rJMFF025K14- CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
                      ____________________________________________________________
consensus CTTGAAGTCTCCATCCTCAATAGCCGGAACCTGTCCGAAGGGCTGGCGACGCAAAAACTC
 
. : . : . : . : . : . :
rJMFF009G08- ANGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF003H23- AGGAGTTTTGTGCTCGAANGACTGGGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF029B11- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF016C12- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF017N21- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF024K15- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMSF029K16- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMSF035F15- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF043D12- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF014J10- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMSF035F15+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF046F05+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF043D12+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN033N20+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF016C12+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF029B11+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN018K20+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF014J10+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF025K14+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF017N21+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF024K15+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF023P11+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFF009G08+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMSF029K16+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN037A06+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN038C20+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN031L12+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN009E22+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN037C12+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
JMFN008F06+ AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
rJMFF025K14- AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
                      ____________________________________________________________
consensus AGGAGTTTTGTGCTCGAAGGACT-GGAGGTCAATATGGATAAGCTCAAAATCCACACCAA
 
. : . : . : . : . : . :
rJMFF009G08- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTG
rJMFF003H23- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTG
rJMFF029B11- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCA
rJMFF016C12- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
rJMFF017N21- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
rJMFF024K15- GCTCAAAGAGACATGCCATCACCCTCTGCGGGACATGCCGCTGTTGCAGAACCGAACACC
rJMSF029K16- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
rJMSF035F15- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
rJMFF043D12- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCC
rJMFF014J10- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMSF035F15+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF046F05+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF043D12+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN033N20+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF016C12+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF029B11+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN018K20+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF014J10+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF025K14+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF017N21+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF024K15+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF023P11+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFF009G08+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMSF029K16+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN037A06+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN038C20+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN031L12+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACAAC
JMFN009E22+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN037C12+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
JMFN008F06+ GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
rJMFF025K14- GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
                      ____________________________________________________________
consensus GCTCAAAGAGACATGCCATCACCCTCTGC-GGACATGCCGCTGTTGCAGAACCGAACACC
 
. : . : . : . : . : . :
rJMFF016C12- TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAAT
rJMFF017N21- TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATG
rJMFF024K15- TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
rJMSF029K16- TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAA
rJMSF035F15- TTAACTACCATATTCACACAACACAATATTANTATTGTANCGATCGAATG
rJMFF014J10- TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGNTAGTTGGTG
JMSF035F15+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF046F05+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF043D12+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN033N20+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF016C12+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF029B11+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN018K20+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF014J10+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF025K14+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF017N21+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF024K15+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF023P11+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFF009G08+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMSF029K16+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN037A06+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN038C20+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN031L12+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN009E22+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN037C12+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
JMFN008F06+ TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
rJMFF025K14- TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
                      ____________________________________________________________
consensus TTAACTACCATATTCACACAACACAATATTAATATTGTAACGATCGAATGTTAGTTGGTG
 
. : . : . : . : . : . :
rJMFF014J10- A
JMSF035F15+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATG
JMFF046F05+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT-GAT
JMFF043D12+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT-GAT
JMFN033N20+ AATGGGTGTATGTTTTTTCCCTTT
JMFF016C12+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATG
JMFF029B11+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT
JMFN018K20+ AATGGGT
JMFF014J10+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT
JMFF025K14+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT
JMFF017N21+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGTG
JMFF024K15+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGTG
JMFF023P11+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGTG
JMFF009G08+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT-GAT
JMSF029K16+ AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT-GAT
JMFN037A06+ AATGGGTGTATGTTTTTTCCCTTTTC
JMFN038C20+ AATGGGTGTATGTTT
JMFN031L12+ AATGGGTGTATGTTTTTTCCCTTT
JMFN009E22+ AATGGGTGTATGTTTTTTCCCTTTTCT
JMFN037C12+ AATGGGTG
JMFN008F06+ AATGGGTGTATGTTTTTTCCCTTT
rJMFF025K14- AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGTCGGTTCTCGACGAA
                      ____________________________________________________________
consensus AATGGGTGTATGTTTTTTCCCTTTTCTTTTTATTTAATTTGAATGT-GATTCTCGACGAA