Previous Contig 009392:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010C02Sequence568009392 (12)gb:AY395738_16048276e-73Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.776009392 (12)gb:AY395738_1604827e-112Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.
JMFF025F16Sequence537009392 (12)gb:AY395738_16048271e-63Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.832009392 (12)gb:AY395738_1604827e-121Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.
JMFF033F15Sequence598009392 (12)gb:AY395738_16048279e-84Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.775009392 (12)gb:AY395738_1604827e-113Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.
JMFF041G20Sequence629009392 (12)gb:AY395738_16048271e-83Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.579009392 (12)gb:AY395738_16048272e-79Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.
JMSF013F22Sequence215009392 (12)gb:AY395739_16048281e-22Nicotiana tabacum ribosomal protein L3B (RPL3B) mRNA, complete cds.760009392 (12)gb:AY395738_1604827e-113Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.
JMSF017C17Sequence462009392 (12)gb:AY456411_16071865e-49Lycopersicon esculentum ribosomal protein L3 (RPL3) mRNA, complete cds.773009392 (12)gb:AY395738_1604827e-109Nicotiana tabacum ribosomal protein L3A (RPL3A) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF017C17- GAGT
JMFF010C02- CCTAGTTGAGT
JMFF025F16- GAGT
JMFF033F15- GAGT
                      ____________________________________________________________
consensus CCTAGTTGAGT
 
. : . : . : . : . : . :
JMSF017C17- GAAGCTTGAAGCTCCCTAGCAGGGTTTGGAGGAGGAGAAGGATGTCGCACAGGAAGTTTG
JMSF013F22- GGTTTGGAGGAGGAGAAGGATGTCGCACAGGAAGTTTG
JMFF010C02- GAAGCTTGAAGCTCCCTA----GGTTTGGAGGAGGAGAAGGATGTCGCACAGGAAGTTTG
JMFF025F16- GAAGCTTGAAGCTCCCTA----GGTTTGGAGGAGGAGAAGGATGTCGCACAGGAAGTTTG
JMFF033F15- GAAGCTTGAAGCTCCCTA----GGTTTGGAGGAGGAGAAGGATGTCGCACAGGAAGTTTG
JMFF041G20- GAAGGATGTCGCACAGGAAGTTTG
                      ____________________________________________________________
consensus GAAGCTTGAAGCTCCCTA----GGTTTGGAGGAGGAGAAGGATGTCGCACAGGAAGTTTG
 
. : . : . : . : . : . :
JMSF017C17- AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
JMSF013F22- AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
JMFF010C02- AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
JMFF025F16- AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
JMFF033F15- AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
JMFF041G20- AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
                      ____________________________________________________________
consensus AGCACCCAAGGCATGGCTCACTCGGCTTTCTTCCCAGAAAGCGTGCTTCTCGCCAAAGGG
 
. : . : . : . : . : . :
JMSF017C17- GAAAGGTGAAAGCATTTCCCAAGGATGATGCCTCCAAACCATGCAGGCTGACTGCATTCT
JMSF013F22- GAAAGGTGAAAGCATTTCCCAAGGATGATGCCTCCAAACCATGCAGGCTGACTGCATTCT
JMFF010C02- GAAAGGTGAAAGCATTTCCCAAGGATGATGCCTCCAAACCATGCAGGCTGACTGCATTCT
JMFF025F16- GAAAGGTGAAAGCATTTCCCAATGATGATGCCTCCAAACCATGCAGGCTGACTTCATTCT
JMFF033F15- GAAAGGTGAAAGCATTTCCCAAGGATGATGCCTCCAAACCATGCAGGCTGACTGCATTCT
JMFF041G20- GAAAGGTGAAAGCATTTCCCAAGGATGATGCCTCCAAACCATGCAGGCTGACTGCATTCT
                      ____________________________________________________________
consensus GAAAGGTGAAAGCATTTCCCAAGGATGATGCCTCCAAACCATGCAGGCTGACTGCATTCT
 
. : . : . : . : . : . :
JMSF017C17- TGGGGTACAAAGCTGGGATGACTCACATTGTCAGAGAAGTGGAGAAACCTGGATCCAAAC
JMSF013F22- TGGGGTACAAAGCTGGAATGACTCACATTG
JMFF010C02- TGGGGTACAAAGCTGGAATGACTCACATTGTCAGAGAAGTGGAGAAACCTGGATCCAAAC
JMFF025F16- TGGGGTACAAAGCTGGAATGACTCACATTGTCAGAGAAGTGGAGAAACCTGGATCCAAAC
JMFF033F15- TGGGGTACAAAGCTGGAATGACTCACATTGTCAGAGAAGTGGAGAAACCTGGATCCAAAC
JMFF041G20- TGGGGTACAAAGCTGGAATGACTCACATTGTCAGAGAAGTGGAGAAACCTGGATCCAAAC
                      ____________________________________________________________
consensus TGGGGTACAAAGCTGGAATGACTCACATTGTCAGAGAAGTGGAGAAACCTGGATCCAAAC
 
. : . : . : . : . : . :
JMSF017C17- TTCACAAGAAGGAGACCTGTGAGGCTGTGACAATCGTTGAGACACCTCCAATTGTAA-TT
JMFF010C02- TTCACAAGAAGGAGACCTGTGAGGCTGTGACAATCGTTGAGACACCTCCAATTGTAATTG
JMFF025F16- TTCACAAGAAGGAGACCTGTGAGGCTGTGACAATCGTTGAGACACCTCCAATTGTAA-TT
JMFF033F15- TTCACAAGAAGGAGACCTGTGAGGCTGTGACAATCGTTGAGACACCTCCAATTGTAATTT
JMFF041G20- TTCACAAGAAGGAGACCTGTGAGGCTGTGACAATCGTTGAGGCACCTCCAATTGTAA-TT
                      ____________________________________________________________
consensus TTCACAAGAAGGAGACCTGTGAGGCTGTGACAATCGTTGAGACACCTCCAATTGTAA-TT
 
. : . : . : . : . : . :
JMSF017C17- GTTGGAGTTGTTGGCTATGTGAAGACACCTCGTGGCCTTCGTTGCCTCAACACAGTTTGG
JMFF010C02- GTTGGAGTTGTTGGCTATGTGAAGACACCTCGTGGCCTTCGTTGCCTCAACACAGTTTGG
JMFF025F16- GTTGGAGTTGTTGGCTATGTGAAGACACCTCGTGGCCTTCGTTGCCTCAACACAGTTTGG
JMFF033F15- GTTGGAGTTGTTGGCTATGTGAAGACACCTCGTGGCCTTCGTTGCCTCAACACAGTTTGG
JMFF041G20- GTTGGAGTTGTTGGCTATGTGAAGACACCTCGTGGCCTTCGTTGCCTCAACACAGTTTGG
                      ____________________________________________________________
consensus GTTGGAGTTGTTGGCTATGTGAAGACACCTCGTGGCCTTCGTTGCCTCAACACAGTTTGG
 
. : . : . : . : . : . :
JMSF017C17- GCTCAGCATCTGAGTGAGGAGGTGAGAAGGAGATTTTACAAGAACTGGTGCAAGTCCAAG
JMFF010C02- GCTCAGCATCTGAGTGAGGAGGTGAGAAGGAGATTTTACAAGAACTGGTGCAAGTCCAAG
JMFF025F16- GCTCAGCATCTGAGTGAGGAGGTGAGAAGGAGATTTTACAAGAACTGGTGCAAGTCCAAG
JMFF033F15- GCTCAGCATCTGAGTGAGGAGGTGAGAAGGAGATTTTACAAGAACTGGTGCAAGTCCAAG
JMFF041G20- GCTCAGCATCTGAGTGAGGAGGTGAGAAGGAGATTTTACAAGAACTGGTGCAAGTCCAAG
                      ____________________________________________________________
consensus GCTCAGCATCTGAGTGAGGAGGTGAGAAGGAGATTTTACAAGAACTGGTGCAAGTCCAAG
 
. : . : . : . : . : . :
JMSF017C17- AAAAAGGCTTTTGTCAAGTATTCAAAGAAATATGAATC
JMFF010C02- AAAAAGGCTTTTGTCAAGTATTCAAAGAAATATGAATCTGAGGATGGTAAGAGGGATATT
JMFF025F16- AAAAAGGCTTTTGTCAAGTATTCAAAGAAATATGAATCTGAGGATGGTAAGAAGGATATT
JMFF033F15- AAAAAGGCTTTTGTCAAGTATTCAAAGAAATATGAATCTGAGGATGGTAAGAAGGATATT
JMFF041G20- AAAAAGGCTTTTGTCAAGTATTCAAAGAAATATGAATCTGAGGATGGTAAGAAGGATATT
                      ____________________________________________________________
consensus AAAAAGGCTTTTGTCAAGTATTCAAAGAAATATGAATCTGAGGATGGTAAGAAGGATATT
 
. : . : . : . : . : . :
JMFF010C02- GAAACACAGCTTGAGAAGATGAAGAAATATGCATGTGTCATTCGTGTGTTGGCTCACACC
JMFF025F16- GAAACACAGCTTGAGAAGATGAAGAAATATGCATGTGTCATTCGTGTGTTGGCTCACA
JMFF033F15- GAAACACAGCTTGAGAAGATGAAGAAATATGCATGTGTCATTCGTGTGTTGGCTCACACC
JMFF041G20- GAAACACAGCTTGAGAAGATGAAGAAATATGCATGTGTCATTCGTGTGTTGGCTCACACC
                      ____________________________________________________________
consensus GAAACACAGCTTGAGAAGATGAAGAAATATGCATGTGTCATTCGTGTGTTGGCTCACACC
 
. : . : . : . : . : . :
JMFF010C02- CANATAAGGAAAATGAAGGGG
JMFF033F15- CAGATAAGGAAAATGAAGGGGCTGAAGCAGAAGAAGGCTCATTTGATGGAG
JMFF041G20- CAGATAAGGAAAATGAAGGGGCTGAAGCAGAAGAAGGCTCATTTGATGGAGATCCAGGTT
rJMFF010C02+ TCCAGGTT
rJMFF033F15+ GGAGATCCAGGTT
rJMSF017C17+ TGATGGAGATCCAGGTT
rJMSF013F22+ ATCCAGGTT
rJMFF025F16+ ATGAAGGGGCTGAAGCAGAAGAAGGCTCATTTGATGGAGATCCAGGTT
                      ____________________________________________________________
consensus CAGATAAGGAAAATGAAGGGGCTGAAGCAGAAGAAGGCTCATTTGATGGAGATCCAGGTT
 
. : . : . : . : . : . :
JMFF041G20- AATGGTGGGACAATTGC
rJMFF010C02+ AATGGTGGGACAATTGCACAGAAGGTTGACTATGCATATGGTTTCTTTGAGAAGCATGTG
rJMFF033F15+ AATGGTGGGACAATTGCACAGAAGGTTGACTATGCATATGGTTTCTTTGAGAAGCATGTG
rJMSF017C17+ AATGGTGGGACAA-TGCACAGAAGGTTGACTATGCATATGGTTTCTTTGAGAAGCATGTG
rJMSF013F22+ AATGGTGGGACAATTGCACAGAAGGTTGACTATGCATATGGTTTCTTTGAGAAGCATGTG
rJMFF025F16+ AATGGTGGGACAATTGCACAGAAGGTTGACTATGCATATGGTTTCTTTGAGAAGCATGTG
                      ____________________________________________________________
consensus AATGGTGGGACAATTGCACAGAAGGTTGACTATGCATATGGTTTCTTTGAGAAGCATGTG
 
. : . : . : . : . : . :
rJMFF010C02+ CCAGTCGATGCTGTTTTCCAGAAGGATGAGATGATTGATATCATTGGTGTCACCAAGGGT
rJMFF033F15+ CCAGTCGATGCTGTTTTCCAGAAGGATGAGATGATTGATATCATTGGTGTCACCAAGGGT
rJMSF017C17+ CCAGTCGATGCTGTTTTCCAGAAGGATGAGATGATTGATATCATTGGTGTCACCAAGGGT
rJMSF013F22+ CCAGTCGATGCTGTTTTCCAGAAGGATGAGATGATTGATATCATTGGTGTCACCAAGGGT
rJMFF025F16+ CCAGTCGATGCTGTTTTCCAGAAGGATGAGATGATTGATATCATTGGTGTCACCAAGGGT
                      ____________________________________________________________
consensus CCAGTCGATGCTGTTTTCCAGAAGGATGAGATGATTGATATCATTGGTGTCACCAAGGGT
 
. : . : . : . : . : . :
rJMFF041G20+ TCCACGTAAAACTCAT
rJMFF010C02+ AAGGGTTATGAAGGTGTTGTGACTCGATGGGGTGTCACTCGTCTTCCACGTAAAACTCAT
rJMFF033F15+ AAGGGTTATGAAGGTGTTGTGACTCGATGGGGTGTCACTCGTCTTCCACGTAAAACTCAT
rJMSF017C17+ AAGGGTTATGAAGGTGTTGTGACTCGATGGGGTGTCACTCGTCTTCCACGTAAAACTCAT
rJMSF013F22+ AAGGGTTATGAAGGTGTTGTGACTCGATGGGGTGTCACTCGTCTTCCACGTAAAACTCAT
rJMFF025F16+ AAGGGTTATGAAGGTGTTGTGACTCGATGGGGTGTCACTCGTCTTCCACGTAAAACTCAT
                      ____________________________________________________________
consensus AAGGGTTATGAAGGTGTTGTGACTCGATGGGGTGTCACTCGTCTTCCACGTAAAACTCAT
 
. : . : . : . : . : . :
rJMFF041G20+ AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
rJMFF010C02+ AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
rJMFF033F15+ AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
rJMSF017C17+ AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
rJMSF013F22+ AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
rJMFF025F16+ AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
                      ____________________________________________________________
consensus AGAGGTCTTCGTAAAGTTGCCTGTATTGGTGCCTGGCATCCAGCTAGAGTTTCATTCACA
 
. : . : . : . : . : . :
rJMFF041G20+ GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
rJMFF010C02+ GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
rJMFF033F15+ GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
rJMSF017C17+ GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
rJMSF013F22+ GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
rJMFF025F16+ GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
                      ____________________________________________________________
consensus GTTGCCCGTGCTGGTCAAAATGGATACCATCACCGAACTGAGTTGAACAAAAAGATTTAT
 
. : . : . : . : . : . :
rJMFF041G20+ AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
rJMFF010C02+ AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
rJMFF033F15+ AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
rJMSF017C17+ AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
rJMSF013F22+ AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
rJMFF025F16+ AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
                      ____________________________________________________________
consensus AAGCTTGGCAAGGTTGGACAAGAGTCGCATGAAGCCATAACTGAGTTTGACAGGACTGAG
 
. : . : . : . : . : . :
rJMFF041G20+ AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
rJMFF010C02+ AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
rJMFF033F15+ AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
rJMSF017C17+ AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
rJMSF013F22+ AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
rJMFF025F16+ AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
                      ____________________________________________________________
consensus AAAGACATTACCCCCATGGGTGGGTTTCCTCACTATGGTGTGGTGAAGGACGACTACATC
 
. : . : . : . : . : . :
rJMFF041G20+ TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
rJMFF010C02+ TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
rJMFF033F15+ TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
rJMSF017C17+ TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
rJMSF013F22+ TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
rJMFF025F16+ TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
                      ____________________________________________________________
consensus TTGATCAAGGGATGCTGTGTTGGCCCTAAGAAAAGAGTGGTTACCCTTCGTCAAACTCTG
 
. : . : . : . : . : . :
rJMFF041G20+ CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
rJMFF010C02+ CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
rJMFF033F15+ CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
rJMSF017C17+ CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
rJMSF013F22+ CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
rJMFF025F16+ CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
                      ____________________________________________________________
consensus CTCAACCAGACCTCTCGTGTTGCTCTTGAGGAGATTAAGCTCAAGTTCATTGACACTTCA
 
. : . : . : . : . : . :
rJMFF041G20+ TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
rJMFF010C02+ TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
rJMFF033F15+ TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
rJMSF017C17+ TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
rJMSF013F22+ TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
rJMFF025F16+ TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
                      ____________________________________________________________
consensus TCAAAGTTTGGACATGGTCGCTTCCAGACAACACAGGAGAAGCAGAAATTCTACGGTCGT
 
. : . : . : . : . : . :
rJMFF041G20+ CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
rJMFF010C02+ CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
rJMFF033F15+ CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
rJMSF017C17+ CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
rJMSF013F22+ CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
rJMFF025F16+ CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
                      ____________________________________________________________
consensus CTCAAGGCTTAAGTATTCCCTTAGGTTTCTTGGTGTTCCAACCATTGTCAGTTGTTTTGT
 
. : . : . : . : . : . :
rJMFF041G20+ AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
rJMFF010C02+ AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
rJMFF033F15+ AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
rJMSF017C17+ AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
rJMSF013F22+ AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
rJMFF025F16+ AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
                      ____________________________________________________________
consensus AGACATATTCCTAAGTGTTTCATTTACTGGATTTTGTGGAAATTTTGTTGCTTGCCTTAG
 
. : . : . : . : . : . :
rJMFF041G20+ GAATTTATCTTTTATTGATTCTT
rJMFF010C02+ GAATTTATCTTTTATTGATTCTTAGAGGATATTTGTTTCCAT
rJMFF033F15+ GAATTTATCTTTTATTGATTCTTAGAGGATATT
rJMSF017C17+ GAATTTATCTTTTATTGATTCTTAGAGGATATT
rJMSF013F22+ GAATTTATCTTTTATTGATTCTTAGAGGATA
rJMFF025F16+ GAATTTATCTTTTATTGATTCTTAGAGGATATTTGTTTCCATTTCAATACTAATACAAGT
                      ____________________________________________________________
consensus GAATTTATCTTTTATTGATTCTTAGAGGATATTTGTTTCCATTTCAATACTAATACAAGT