Previous Contig 009388:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF025E16Sequence815009388 (3)gb:BT006409_16392961e-71Arabidopsis thaliana At5g11950 gene, complete cds.
JMSF027F16Sequence600009388 (3)gb:BT006409_16392965e-20Arabidopsis thaliana At5g11950 gene, complete cds.778009388 (3)gb:BT006409_16392962e-72Arabidopsis thaliana At5g11950 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027F16- GATCCCTTCTAAGGTGTCTGGTTA
                      ____________________________________________________________
consensus GATCCCTTCTAAGGTGTCTGGTTA
 
. : . : . : . : . : . :
JMSF027F16- GCGAATAGCAACGCTTGATAGAGTTCTACTGCAGATAGAAATGGGCTGTAGATTTGTTGA
                      ____________________________________________________________
consensus GCGAATAGCAACGCTTGATAGAGTTCTACTGCAGATAGAAATGGGCTGTAGATTTGTTGA
 
. : . : . : . : . : . :
JMSF027F16- TCCATGCTGGGCCTTTTACTAACACTAGAAGCTACATGTTTAACCAGACAATATAGATTG
                      ____________________________________________________________
consensus TCCATGCTGGGCCTTTTACTAACACTAGAAGCTACATGTTTAACCAGACAATATAGATTG
 
. : . : . : . : . : . :
JMSF027F16- TCCATGACAAATGAGTATATAGCATCAAAAAGTAGTTTGGCTTTTGTTCGTTTAAAGTAC
                      ____________________________________________________________
consensus TCCATGACAAATGAGTATATAGCATCAAAAAGTAGTTTGGCTTTTGTTCGTTTAAAGTAC
 
. : . : . : . : . : . :
JMSF027F16- ACAGCCTTCACATCTTTCTTGTTCTTGTTTCCCTCACCATTCCTCATCCACCCCCAGTAA
                      ____________________________________________________________
consensus ACAGCCTTCACATCTTTCTTGTTCTTGTTTCCCTCACCATTCCTCATCCACCCCCAGTAA
 
. : . : . : . : . : . :
JMSF027F16- AAATAAGCGAAAATAGAAAGAAATTAAATACTCTTTGCTCGAAGAATGGGGGGAGAACCG
rJMSF027F16+ AGAACCG
                      ____________________________________________________________
consensus AAATAAGCGAAAATAGAAAGAAATTAAATACTCTTTGCTCGAAGAATGGGGGGAGAACCG
 
. : . : . : . : . : . :
JMSF027F16- GGAGATCATCATCAGGCATCTAACAGCGATGAAAAGAAGCGAAGGTTTAAGAGAATTTGT
rJMSF027F16+ GGAGATCATCATCAGGCATCTAACAGCGATGAAAAGAAGCGAAGGTTTAAGAGAATTTGT
rJMFF025E16+ GCGATGAAAAGAAGCGAAGGTTTAAGAGAATTTGT
                      ____________________________________________________________
consensus GGAGATCATCATCAGGCATCTAACAGCGATGAAAAGAAGCGAAGGTTTAAGAGAATTTGT
 
. : . : . : . : . : . :
JMSF027F16- GTTTTCTGTGGTAGTAGGACTGGTTATAGATCGTCGTTCAGTGATGCAGCTCTTCAGCTT
rJMSF027F16+ GTTTTCTGTGGTAGTAGGACTGGTTATAGATCGTCGTTCAGTGATGCAGCTCTTCAGCTT
rJMFF025E16+ GTTTTCTGTGGTAGTAGGACTGGTTATAGATCGTCGTTCAGTGATGCAGCTCTTCAGCTT
                      ____________________________________________________________
consensus GTTTTCTGTGGTAGTAGGACTGGTTATAGATCGTCGTTCAGTGATGCAGCTCTTCAGCTT
 
. : . : . : . : . : . :
JMSF027F16- GGTAAAGAACTGGTTGAACGAAAGATTGACCTGGTTTACGGTGGAGGAAGCGTTGGGTTG
rJMSF027F16+ GGTAAAGAACTGGTTGAACGAAAGATTGACCTGGTTTACGGTGGAGGAAGCGTTGGGTTG
rJMFF025E16+ GGTAAAGANCTGGTTGAACGAAAGATTGACCTGGTTTACGGTGGAGGAAGCGTTGGGTTG
                      ____________________________________________________________
consensus GGTAAAGAACTGGTTGAACGAAAGATTGACCTGGTTTACGGTGGAGGAAGCGTTGGGTTG
 
. : . : . : . : . : . :
JMSF027F16- ATGGGTTTAGTCTCTAAAACCGTCTTTGATGGAGGGTGTCATGTTCTAGGAGTAATCCCT
rJMSF027F16+ ATGGGTTTAGTCTCTAAAACCGTCTTTGATGGAGGGTGTCATGTTCTAGGAGTAATCCCT
rJMFF025E16+ ATGGGTTTAGTCTCTAAAACCGTCTTTGATGGAGGGTGTCATGTTCTAGGAGTAATCCCT
                      ____________________________________________________________
consensus ATGGGTTTAGTCTCTAAAACCGTCTTTGATGGAGGGTGTCATGTTCTAGGAGTAATCCCT
 
. : . : . : . : . : . :
JMSF027F16- AAGGCCCTCTTGCCACATGAGATATCTGGAGAAACC
rJMSF027F16+ AAGGCCCTCTTGCCACATGAGATATCTGGAGAAACCGTGGGGGATCTAAAAGTAGTGACG
rJMFF025E16+ AAGGCCCTCTTGCCACATGAGATATCTGGAGAAACCGTGGGGGATCTAAAAGTAGTGACG
                      ____________________________________________________________
consensus AAGGCCCTCTTGCCACATGAGATATCTGGAGAAACCGTGGGGGATCTAAAAGTAGTGACG
 
. : . : . : . : . : . :
rJMSF027F16+ GACATGCACCAGAGAAAGTCAGAAATGGAGAGAAACGCTGATGCTTTCATCGCACTTCCT
rJMFF025E16+ GACATGCACCAGAGAAAGTCAGAAATGGAGAGAAACGCTGATGCTTTCATCGCACTTCCT
                      ____________________________________________________________
consensus GACATGCACCAGAGAAAGTCAGAAATGGAGAGAAACGCTGATGCTTTCATCGCACTTCCT
 
. : . : . : . : . : . :
rJMSF027F16+ GGCGGTTACGGGACCATGGAGGAATTGCTCGAAGTGATAACCTGGTCTCAATTGGGAATC
rJMFF025E16+ GGCGGTTACGGGACCATGGAGGAATTGCTCGAAGTGATAACCTGGTCTCAATTGGGAATC
                      ____________________________________________________________
consensus GGCGGTTACGGGACCATGGAGGAATTGCTCGAAGTGATAACCTGGTCTCAATTGGGAATC
 
. : . : . : . : . : . :
rJMSF027F16+ CATGAAAAGCCAGTTGGGCTGTTAAACGTGGATGGCTATTATGATGGGCTGCTTGCATTG
rJMFF025E16+ CATGAAAAGCCAGTTGGGCTGTTAAACGTGGATGGCTATTATGATGGGCTGCTTGCATTG
                      ____________________________________________________________
consensus CATGAAAAGCCAGTTGGGCTGTTAAACGTGGATGGCTATTATGATGGGCTGCTTGCATTG
 
. : . : . : . : . : . :
rJMSF027F16+ TTCGACAAGGGAGTGGAGGAAGGCTTCATCGACGATTCAGCAAGAAACATAGTGGTGTTA
rJMFF025E16+ TTCGACAAGGGAGTGGAGGAAGGCTTCATCGACGATTCAGCAAGAAACATAGTGGTGTTA
                      ____________________________________________________________
consensus TTCGACAAGGGAGTGGAGGAAGGCTTCATCGACGATTCAGCAAGAAACATAGTGGTGTTA
 
. : . : . : . : . : . :
rJMSF027F16+ GGCGACACAGCCAAGGACTTAATCACGAAAATGGAGGAGTATGCACCGGGTCACGACAGA
rJMFF025E16+ GGCGACACAGCCAAGGACTTAATCACGAAAATGGAGGAGTATGCACCGGGTCACGACAGA
                      ____________________________________________________________
consensus GGCGACACAGCCAAGGACTTAATCACGAAAATGGAGGAGTATGCACCGGGTCACGACAGA
 
. : . : . : . : . : . :
rJMSF027F16+ GTTGCAACGAGACAAAGCTGGGAAGTGGAGCAATTATTAGAGTCTACTTCTTCAAGTGGG
rJMFF025E16+ GTTGCAACGAGACAAAGCTGGGAAGTGGAGCAATTATTAGAGTCTACTTCTTCAAGTGGG
                      ____________________________________________________________
consensus GTTGCAACGAGACAAAGCTGGGAAGTGGAGCAATTATTAGAGTCTACTTCTTCAAGTGGG
 
. : . : . : . : . : . :
rJMSF027F16+ GAAACCCATGGTATCTTAGATGATGATGAAGATGAAGATCAGGCTATATAATCATGGTTG
rJMFF025E16+ GAAACCCATGGTATCTTAGATGATGATGAAGATGAAGATCAGGCTATATAATCATGGTTG
                      ____________________________________________________________
consensus GAAACCCATGGTATCTTAGATGATGATGAAGATGAAGATCAGGCTATATAATCATGGTTG
 
. : . : . : . : . : . :
rJMSF027F16+ TTGCTTATGATTATGTTGTGTTTTTTGTTTTTGTTTTTGTAGTTGTTCCAT
rJMFF025E16+ TTGCTTATGATTATGTTGTGTTTTTTGTTTTTGTTTTTGTAGTTGTTCCATTTTAATCAC
                      ____________________________________________________________
consensus TTGCTTATGATTATGTTGTGTTTTTTGTTTTTGTTTTTGTAGTTGTTCCATTTTAATCAC
 
. : . : . : . : . : . :
rJMFF025E16+ AATGAAAGGGACTGGATATCCTAGCCAGGCCTTGTCTATCTACTGTTGATATACACAAGT
                      ____________________________________________________________
consensus AATGAAAGGGACTGGATATCCTAGCCAGGCCTTGTCTATCTACTGTTGATATACACAAGT